July 2008 Archives by subject

• Messages sorted by: [ thread ] [ author ] [ date ]
• More info on this list...

Starting: Tue Jul 1 00:45:40 CEST 2008
Ending: Thu Jul 31 23:47:46 CEST 2008
Messages: 3282

• [R] "dens" function   Shubha Vishwanath Karanth
• [R] "Invalid object" error in boxplot   mm745 at st-andrews.ac.uk
• [R] "Invalid object" error in boxplot   Erik Iverson
• [R] "lwd" gives different plotted line widths for Vertical and horizontal Lines when lwd= 2?   hadley wickham
• [R] "lwd" gives different plotted line widths for Vertical and horizontal Lines when lwd= 2?   hadley wickham
• [R] "lwd" gives different plotted line widths for Vertical and horizontal Lines when lwd= 2?   Pedro de Barros
• [R] "lwd" gives different plotted line widths for Vertical and horizontal Lines when lwd= 2?   Pedro de Barros
• [R] "Multiple" Regressions indexed by goodness of fit   stephen sefick
• [R] "non-sample" standard-deviation   el_eli at gmx.de
• [R] "non-sample" standard-deviation   Daniel Malter
• [R] "Reasonable doubt" - was "Re: shapiro wilk normality test"   S Ellison
• [R] "Rotated Lat-Lon" projection in mapproj   Victor Homar
• [R] "Spreading risk" in a matrix   ACroske
• [R] "Spreading risk" in a matrix   ONKELINX, Thierry
• [R] "Spreading risk" in a matrix   ACroske
• [R] "Spreading risk" in a matrix   ONKELINX, Thierry
• [R] "wave model" semivariogram   Alessandro
• [R] 'as.Date' conversion of classes POSIX*t (problem/feature)?   Angel Spassov
• [R] 'as.Date' conversion of classes POSIX*t (problem/feature)?   Gabor Grothendieck
• [R] 'for' loop, two variables   Oehler, Friderike (AGPP)
• [R] 'for' loop, two variables   Duncan Murdoch
• [R] 'for' loop, two variables   ONKELINX, Thierry
• [R] 'for' loop, two variables   Benno Pütz
• [R] 'system' command through Rserve   Patil, Prasad
• [R] 'system' command through Rserve   Jeffrey Horner
• [R] (no subject)   Silika Prohl
• [R] (no subject)   Paul Adams
• [R] (no subject)   jim holtman
• [R] *** significance with xtable   Bunny, lautloscrew.com
• [R] *** significance with xtable   Marc Schwartz
• [R] .asp (not really an R question) but related   stephen sefick
• [R] .asp (not really an R question) but related   Gabor Grothendieck
• [R] .First and .Rprofile won't run on startup   Susan Amrose
• [R] .First and .Rprofile won't run on startup   Rolf Turner
• [R] .First and .Rprofile won't run on startup   Bryan Hanson
• [R] .First and .Rprofile won't run on startup   Susan Amrose
• [R] .Last() and namespace   Ralf Tautenhahn
• [R] .Rprofile in RFrameworks?   Fredrik Lundgren
• [R] 2 Courses*** R/Splus Advanced Programming : August 14-15 in Seattle ! by XLSolutions Corp   sue at xlsolutions-corp.com
• [R] 64-bit R on Mac OS X 10.4.5   joseph
• [R] 64-bit R on Mac OS X 10.4.5   Steven McKinney
• [R] 64-bit R on Mac OS X 10.4.5   Matthew Keller
• [R] 64-bit R on Mac OS X 10.5.4   joseph
• [R] 64-bit R on Mac OS X 10.5.4   joseph
• [R] [-->OT] was: Re: Legality Question about R's Open Source GNU GPL License   (Ted Harding)
• [R] [Ask]Robust Buckley-James like estimator   abdul kudus
• [R] [Fwd: Re: Insurance review statistical methods]   Kenneth Roy Cabrera Torres
• [R] [Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?]   Gustaf Rydevik
• [R] [Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?]   Michal Figurski
• [R] [Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?]   Frank E Harrell Jr
• [R] [Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?]   Michal Figurski
• [R] [R-pkgs] Functional Data Analysis, fda_1.2.4   Spencer Graves
• [R] [R-pkgs] hwriter - Writing R objects in HTML format   Gregoire Pau
• [R] [R-pkgs] Package np version 0.20-0 released to CRAN   Jeffrey S. Racine
• [R] [R-pkgs] ppls: version 1.02 including a new data set   Nicole Kraemer
• [R] [R-pkgs] randomSurvivalForest 3.5.0 now available   Udaya B. Kogalur
• [R] [R-sig-Geo] Spatial Sample   Paul Hiemstra
• [R] [R-sig-Geo] Spatial Sample   Roger Bivand
• [R] A (not so) Short Introduction to S4   Christophe Genolini
• [R] A easy way to write formula   Jinsong Zhao
• [R] A easy way to write formula   ONKELINX, Thierry
• [R] A easy way to write formula   Mark Difford
• [R] A easy way to write formula   hadley wickham
• [R] A neural network problem---neuralnet package   Shubha Vishwanath Karanth
• [R] A question about using function plot   Jason Liao
• [R] A question about using function plot   Sarah Goslee
• [R] A question about using function plot   Henrique Dallazuanna
• [R] A question about using function plot   Chuck Cleland
• [R] A question about using function plot   Robert Baer
• [R] A question about using function plot   Richard M. Heiberger
• [R] A question on the quandratic programming   Yunlei.Hu at barclayscapital.com
• [R] A quick question about lm()   rlearner309
• [R] A quick question about lm()   Henrique Dallazuanna
• [R] A quick question about lm()   (Ted Harding)
• [R] A quick question about lm()   Tobias Verbeke
• [R] A quick question about lm()   ONKELINX, Thierry
• [R] A quick question about lm()   (Ted Harding)
• [R] A regression problem using dummy variables   rlearner309
• [R] A regression problem using dummy variables   Moshe Olshansky
• [R] A regression problem using dummy variables   rlearner309
• [R] A regression problem using dummy variables   rlearner309
• [R] A regression problem using dummy variables   Thomas Lumley
• [R] A regression problem using dummy variables   rlearner309
• [R] A regression problem using dummy variables   Peter Dalgaard
• [R] A regression problem using dummy variables   Ron Michael
• [R] A regression problem using dummy variables   Bert Gunter
• [R] A regression problem using dummy variables   rlearner309
• [R] A regression problem using dummy variables   Ron Michael
• [R] A shorter version of ".Last.value"?   Jon Zadra
• [R] A shorter version of ".Last.value"?   Gabor Grothendieck
• [R] A shorter version of ".Last.value"?   Peter Dalgaard
• [R] A shorter version of ".Last.value"?   Peter Dalgaard
• [R] a warning message from lmer   Lan Wei
• [R] a warning message from lmer   Douglas Bates
• [R] a warning message from lmer   Douglas Bates
• [R] a warning message from lmer   Lan Wei
• [R] About clustering techniques   pacomet
• [R] About clustering techniques   ctu at bigred.unl.edu
• [R] About clustering techniques   Christian Hennig
• [R] About clustering techniques   Christian Hennig
• [R] About clustering techniques   pacomet
• [R] about EM algorithm   Peng Jiang
• [R] about EM algorithm   Patrick Burns
• [R] Access to values of function arguments   willemf
• [R] Access to values of function arguments   Prof Brian Ripley
• [R] Access to values of function arguments   Marc Schwartz
• [R] Access to values of function arguments   willemf
• [R] Access to values of function arguments   jim holtman
• [R] Accessing a field in a data fram   R_Learner
• [R] Accessing a field in a data fram   jim holtman
• [R] Accessing a field in a data fram   Marc Schwartz
• [R] Accessing individual variables from summary of lm   ascentnet
• [R] Accessing individual variables from summary of lm   Paul Smith
• [R] Accessing individual variables from summary of lm   ascentnet
• [R] Accessing individual variables from summary of lm   Mark Difford
• [R] Accessing individual variables from summary of lm   Mark Difford
• [R] accessing list elements   Paul Adams
• [R] accessing list elements   Sarah Goslee
• [R] accessing list elements   Erik Iverson
• [R] ace error because of missings?   Birgitle
• [R] Add a Vector to a Matrix   ascentnet
• [R] Add a Vector to a Matrix   Marc Schwartz
• [R] Add comments on plot window   Jim Lemon
• [R] Add comments on plot window   mysimbaa
• [R] Add comments on plot window   Gabor Grothendieck
• [R] add string   Alfredo Alessandrini
• [R] add string   john seers (IFR)
• [R] adding a package in Windows   Lana Schaffer
• [R] adding a package in Windows   Duncan Murdoch
• [R] adding lines to multiple plot   Gary W
• [R] adding lines to multiple plot   Ben Bolker
• [R] adding lines to multiple plot   Gary W
• [R] adding lines to multiple plot   Ben Bolker
• [R] adding lines to multiple plots   Gary W
• [R] adding the mean and standard deviation to boxplots   Fernando Marmolejo-Ramos
• [R] adding the mean and standard deviation to boxplots   jim holtman
• [R] adding the mean and standard deviation to boxplots   John Kane
• [R] adding the mean and standard deviation to boxplots   HBaize
• [R] adtest for weibull distribution   René Pineda
• [R] aggregate months to years   Oehler, Friderike (AGPP)
• [R] aggregate months to years   Henrique Dallazuanna
• [R] aggregate() function and na.rm = TRUE   David Afshartous
• [R] aggregate() function and na.rm = TRUE   Daniel Malter
• [R] Aggregating zoo object with NAs in multiple column   Abiel Reinhart
• [R] Aggregating zoo object with NAs in multiple column   Achim Zeileis
• [R] Akaike or BIC criteria for feed-forward neural nets   Prof Brian Ripley
• [R] allocMatrix limits   Vadim Kutsyy
• [R] allocMatrix limits   Prof Brian Ripley
• [R] alternate usage of soil.texture (plotrix)   Dylan Beaudette
• [R] alternate usage of soil.texture (plotrix)   Jim Lemon
• [R] ampersand char in the path causing error message when running rscript.bat   Zroutik Zroutik
• [R] an extremely simple question   Edna Bell
• [R] an extremely simple question   milton ruser
• [R] an extremely simple question   Michael Kubovy
• [R] Analysis of poorly replicated array data   Eli Meyer
• [R] Analysis of poorly replicated array data   Wolfgang Huber
• [R] Analyzing Intervals between Data   Jia Ying Mei
• [R] Analyzing Intervals between Data   jim holtman
• [R] Analyzing Intervals between Data   Jia Ying Mei
• [R] Analyzing Intervals between Data   jim holtman
• [R] Analyzing Intervals between Data   jim holtman
• [R] anisotrophy in fit.variogram problem   Alessandro
• [R] anisotropy in vgm model. HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!   Alessandro
• [R] ANNOUNCE: rapache 1.1.0 release   Jeffrey Horner
• [R] Another failed attempt to install an R package in Ubuntu   Miklos Kiss
• [R] Another failed attempt to install an R package in Ubuntu   IAIN GALLAGHER
• [R] Another failed attempt to install an R package in Ubuntu   Matti Pastell
• [R] Another failed attempt to install an R package in Ubuntu   Vincent Goulet
• [R] Another packaging question   Johannes Huesing
• [R] Another packaging question   Uwe Ligges
• [R] Another packaging question   Johannes Huesing
• [R] Another packaging question   Uwe Ligges
• [R] Any R package about COALESCENT THEORY/GENEOLOGICAL TREES??   muhammad faisal
• [R] Any R package about COALESCENT THEORY/GENEOLOGICAL TREES??   Brad McNeney
• [R] any way to set defaults for par?   Carl Witthoft
• [R] any way to set defaults for par?   jim holtman
• [R] any way to set defaults for par?   Greg Snow
• [R] aov error with large data set   Mike Lawrence
• [R] aov error with large data set   Peter Dalgaard
• [R] apply with a division   Greg Kettler
• [R] apply with a division   Henrique Dallazuanna
• [R] apply with a division   Marc Schwartz
• [R] apply with a division   Gabor Grothendieck
• [R] apply with a division   Abhijit Dasgupta
• [R] apply with a division   Gavin Simpson
• [R] applying complex functions by groups   Finch, W. Holmes
• [R] applying complex functions by groups   jim holtman
• [R] Are centre coordinates or upper left corners used of x, y for SpatialPixels?   Jan.Verbesselt at csiro.au
• [R] Are centre coordinates or upper left corners used of x, y for SpatialPixels?   Paul Hiemstra
• [R] Are centre coordinates or upper left corners used of x, y for SpatialPixels?   Paul Hiemstra
• [R] Are there any packages that can process images other than pixelmap (i.e. pnm)?   Arthur Roberts
• [R] Are there any packages that can process images other than pixelmap (i.e. pnm)?   Henrik Bengtsson
• [R] Area Under a Curve   stephen sefick
• [R] Area Under a Curve   Rolf Turner
• [R] Area Under a Curve   bartjoosen
• [R] as.Date() clarification   Ron Michael
• [R] as.Date() clarification   Achim Zeileis
• [R] as.Date() clarification   Peter Dalgaard
• [R] as.Date() clarification   Martin Maechler
• [R] asp and ylim   David Epstein
• [R] asp and ylim   Rolf Turner
• [R] asp and ylim   David Epstein
• [R] asp and ylim   Gabor Grothendieck
• [R] asp and ylim   Prof Brian Ripley
• [R] asp and ylim   Paul Smith
• [R] asp and ylim   David Epstein
• [R] asp and ylim   David Epstein
• [R] asp and ylim   Martin Maechler
• [R] asp and ylim   David Epstein
• [R] asp and ylim   Martin Maechler
• [R] asp and ylim   Greg Snow
• [R] Assoociative array?   rkevinburton at charter.net
• [R] Assoociative array?   jim holtman
• [R] Assoociative array?   rkevinburton at charter.net
• [R] Assoociative array?   Duncan Murdoch
• [R] Assoociative array?   rkevinburton at charter.net
• [R] Assoociative array?   rkevinburton at charter.net
• [R] Assoociative array?   jim holtman
• [R] Assoociative array?   Duncan Murdoch
• [R] Assoociative array?   rkevinburton at charter.net
• [R] Assoociative array?   Duncan Murdoch
• [R] Assoociative array?   jim holtman
• [R] Assoociative array?   rkevinburton at charter.net
• [R] Assoociative array?   rkevinburton at charter.net
• [R] Assoociative array?   jim holtman
• [R] Assoociative array?   rkevinburton at charter.net
• [R] Assoociative array?   jim holtman
• [R] Assoociative array?   rkevinburton at charter.net
• [R] Assoociative array?   jim holtman
• [R] Assoociative array?   rkevinburton at charter.net
• [R] Assoociative array?   jim holtman
• [R] Assoociative array?   rkevinburton at charter.net
• [R] Assoociative array?   rkevinburton at charter.net
• [R] Assoociative array?   rkevinburton at charter.net
• [R] attributing values to dataframe positions following eval   Stephane Bourgeois
• [R] attributing values to dataframe positions following eval   John Kane
• [R] attributing values to dataframe positions following eval   Greg Snow
• [R] Auto.key colors maintained when subsetting   David Afshartous
• [R] Auto.key colors maintained when subsetting   Deepayan Sarkar
• [R] Auto.key colors maintained when subsetting   David Afshartous
• [R] Auto.key colors maintained when subsetting   Deepayan Sarkar
• [R] Auto.key colors maintained when subsetting   David Afshartous
• [R] auto.key in xyplot in conjunction with panel.text   David Afshartous
• [R] auto.key in xyplot in conjunction with panel.text   Deepayan Sarkar
• [R] auto.key in xyplot in conjunction with panel.text   David Afshartous
• [R] Automatic placement of Legends   tolga.i.uzuner at jpmorgan.com
• [R] Automatic placement of Legends   stephen sefick
• [R] Automatic placement of Legends   Boks, M.P.M.
• [R] Automatic placement of Legends   dogle
• [R] Automatic placement of Legends   Gregor Gorjanc
• [R] Automatic placement of Legends   tolga.i.uzuner at jpmorgan.com
• [R] Automatic placement of Legends   Jim Lemon
• [R] Automatic placement of Legends   Frank E Harrell Jr
• [R] Automatic placement of Legends   tolga.i.uzuner at jpmorgan.com
• [R] average replicate probe values   Kaposi-Novak, Pal
• [R] average replicate probe values   jim holtman
• [R] avoid loop with three-dimensional array   Michela Cameletti
• [R] Avoid loop with three-dimensional array   Michela Cameletti
• [R] avoid loop with three-dimensional array   Charles C. Berry
• [R] Axes in perspective plot - persp()   David Afshartous
• [R] axis.break on Date-x-axis in lattice xyplot   Henning Wildhagen
• [R] axis.break on Date-x-axis in lattice xyplot   Ben Bolker
• [R] axis.break on Date-x-axis in lattice xyplot   Jim Lemon
• [R] Backgrounds in Multiple Plots made with "fig"   Tom La Bone
• [R] Backgrounds in Multiple Plots made with "fig"   Paul Murrell
• [R] Backslash in sub pattern?   Stephan Kolassa
• [R] Backslash in sub pattern?   Marc Schwartz
• [R] barchart with bars attached to y=0-line   Henning Wildhagen
• [R] barchart with bars attached to y=0-line   Gabor Grothendieck
• [R] barchart with bars attached to y=0-line   Deepayan Sarkar
• [R] barchart with bars attached to y=0-line   Henning Wildhagen
• [R] barchart with bars attached to y=0-line   Felix Andrews
• [R] barplot for a categorial variable   kayj
• [R] barplot for a categorial variable   Bill.Venables at csiro.au
• [R] Basic help needed   Luciano La Sala
• [R] Basic help needed   Gabor Grothendieck
• [R] Basic Vector and Matrix Operations   Eric Turkheimer
• [R] Basic Vector and Matrix Operations   Xiaohui Chen
• [R] Basic Vector and Matrix Operations   apjaworski at mmm.com
• [R] Basic Vector and Matrix Operations   Jorge Ivan Velez
• [R] Basic Vector and Matrix Operations   Erik Iverson
• [R] Basic Vector and Matrix Operations   jim holtman
• [R] Beginning lm   rkevinburton at charter.net
• [R] Beginning lm   Mark Difford
• [R] Beginning lm   Marc Schwartz
• [R] Benchmarking R and R Workloads   Imanpreet
• [R] best quad core configuration?   Alan Swanson
• [R] best quad core configuration?   Vincent Goulet
• [R] Biostatistician Positions at Vanderbilt University   Frank E Harrell Jr
• [R] biplot_group_colours_and_point_symbols   Indermaur Lukas
• [R] Bizarre - R crashes on merge   Williams, Robin
• [R] Bizarre - R crashes on merge   Philipp Pagel
• [R] Bizarre - R crashes on merge   Philipp Pagel
• [R] Bland-Altman method to measure agreement with repeated measures   Marc Schwartz
• [R] Bland-Altman method to measure agreement with repeated measures   kende jan
• [R] Bland-Altman method to measure agreement with repeated measures   Nutter, Benjamin
• [R] Bootstrap in betareg()   Leandro Marino
• [R] Bootstraping GAMs for confidence intervales calculation   Luis Reino
• [R] Bootstraping GAMs: confidence intervals   Luis Reino
• [R] Bootstrapping   laila khalfan
• [R] bug in 'margins' behavior in reshape - cast   mfrumin
• [R] bug in 'margins' behavior in reshape - cast   hadley wickham
• [R] bug in 'margins' behavior in reshape - cast   mfrumin
• [R] bug in 'margins' behavior in reshape - cast   hadley wickham
• [R] bug in 'margins' behavior in reshape - cast   Michael Frumin
• [R] bug in 'margins' behavior in reshape - cast   hadley wickham
• [R] bug in 'margins' behavior in reshape - cast   mfrumin
• [R] bug in axis.Date? was (Re: newbie needs help plotting time series)   Petr PIKAL
• [R] Bug in gap.plot   Arthur Roberts
• [R] Bug in gap.plot   Uwe Ligges
• [R] Bug in gap.plot   Jim Lemon
• [R] Bug in gap.plot   Carl Witthoft
• [R] Bug in sd() and var() in handling vectors of NA (R version 2.7.1)?   Marisa Laetitia
• [R] Bug in sd() and var() in handling vectors of NA (R version 2.7.1)?   Prof Brian Ripley
• [R] build matrix with the content of one column of a data frame in function of two factors   VinceD
• [R] build matrix with the content of one column of a data frame in function of two factors   VinceD
• [R] build matrix with the content of one column of a data frame in function of two factors   VinceD
• [R] Building a data frame with missing data   Natalia Quinteros
• [R] Building a data frame with missing data   Henrique Dallazuanna
• [R] building experimental paradigm with R as "Brainard/Pelli PsychToolbox"   Ken Knoblauch
• [R] building experimental paradigm with R as "Brainard/Pelli Psych Toolbox"   guillaume chaumet
• [R] bwplot with Date object   GOUACHE David
• [R] by or tapply?   Michael Denslow
• [R] by or tapply?   jim holtman
• [R] by() function doesn't work inside another function   Russell Ivory
• [R] Cairo graphics   Edna Bell
• [R] Cairo graphics   Philipp Pagel
• [R] calculate differences - strange outcome   Kunzler, Andreas
• [R] calculate differences - strange outcome   Berwin A Turlach
• [R] calculate differences - strange outcome   Mark Difford
• [R] calculate differences - strange outcome   Duncan Murdoch
• [R] calculate differences - strange outcome   Bernardo Rangel Tura
• [R] Calculating Betweenness - Efficiency problem   Senthil Purushothaman
• [R] Calculating Betweenness - Efficiency problem   jim holtman
• [R] Calculating Betweenness - Efficiency problem   Senthil Purushothaman
• [R] Calculating Betweenness - Efficiency problem   jim holtman
• [R] Calculating Betweenness - Efficiency problem   Gabor Csardi
• [R] Calculating Betweenness - Efficiency problem   Senthil Purushothaman
• [R] Calculating Betweenness - Efficiency problem   Gabor Csardi
• [R] Calculating Betweenness - Efficiency problem   Senthil Purushothaman
• [R] Calculating Stream Metabolism   stephen sefick
• [R] calculation of entropy in R???   muhammad faisal
• [R] calculation of entropy in R???   David Reinke
• [R] Calling and running a compiled program inside R   Paek, Insu
• [R] Calling and running a compiled program inside R   jim holtman
• [R] Calling LISP programs in R   francogrex
• [R] Calling LISP programs in R   Steven McKinney
• [R] Can I do regression by steps?   rlearner309
• [R] Can I do regression by steps?   John Sorkin
• [R] Can I do regression by steps?   rlearner309
• [R] Can I do regression by steps?   markleeds at verizon.net
• [R] Can I do regression by steps?   John Sorkin
• [R] Can mvtnorm calculate a sequence of probabilities?   di jianing
• [R] Can R do this ?   Daren Tan
• [R] Can R do this ?   Paul Smith
• [R] Can R do this ?   Gabor Csardi
• [R] Can R do this ?   Mark Difford
• [R] Can R do this ?   Gabor Csardi
• [R] Can R fill in missing values?   Jia Ying Mei
• [R] Can R fill in missing values?   Erik Iverson
• [R] Can R fill in missing values?   Gabor Grothendieck
• [R] Can't compile in HPUX 11.31 on IA64   Jackson,Daniel
• [R] Can't get the correct order from melt.data.frame of reshape library.   Daren Tan
• [R] Can't get the correct order from melt.data.frame of reshape library.   jim holtman
• [R] Can't install package Matrix on solaris.   Scott Brown
• [R] Can't install package Matrix on solaris.   Prof Brian Ripley
• [R] Can't install package Matrix on solaris.   Martin Maechler
• [R] Can't Load Text Files   Jia Ying Mei
• [R] Can't Load Text Files   milton ruser
• [R] Can't Load Text Files   Peter Alspach
• [R] Can't Load Text Files   Jia Ying Mei
• [R] cannot allocate vector of size...   Uwe Ligges
• [R] cannot allocate vector of size...   silvia narduzzi
• [R] Cannot re-start R after bus error   Ralph S.
• [R] Cannot re-start R after bus error   Detlef Steuer
• [R] Cannot re-start R after bus error   Ralph S.
• [R] CART Analysis   Darin Brooks
• [R] CART Analysis   Tobias Verbeke
• [R] CART and CHAID   Chua Siang Li
• [R] CART and CHAID   Prof Brian Ripley
• [R] CART and CHAID   Chua Siang Li
• [R] CART and CHAID   Achim Zeileis
• [R] Case statements in R   Wade Wall
• [R] Case statements in R   Henrik Bengtsson
• [R] Case statements in R   Roland Rau
• [R] Case statements in R   David Katz
• [R] Case statements in R   Stefan Evert
• [R] Case statements in R   (Ted Harding)
• [R] Case statements in R   Henrik Bengtsson
• [R] Case statements in R   Patrick Burns
• [R] Case statements in R   Roland Rau
• [R] cbind help   Rajasekaramya
• [R] cbind help   Henrique Dallazuanna
• [R] cex.axis for the x axis   Pavel77
• [R] cex.axis for the x axis   Mark Difford
• [R] cex.axis for the x axis   Mark Difford
• [R] Change font-face in title   Albin Blaschka
• [R] Change font-face in title   Albin Blaschka
• [R] Change font-face in title   Gabor Grothendieck
• [R] Change font-face in title   jim holtman
• [R] Change font-face in title   Gabor Grothendieck
• [R] Change font-face in title   Albin Blaschka
• [R] Change font-face in title   Mike Prager
• [R] Change font-face in title   Gabor Grothendieck
• [R] Change font-face in title   Mike Prager
• [R] Change in behaviour of sd()   Fiona Johnson
• [R] Change in behaviour of sd()   Rolf Turner
• [R] Change in behaviour of sd()   Henrik Bengtsson
• [R] Change in behaviour of sd()   Duncan Murdoch
• [R] Change in behaviour of sd()   Peter Dalgaard
• [R] Change in behaviour of sd()   Jim Lemon
• [R] Change language in Rcmdr   Schleuh
• [R] Change language in Rcmdr   Duncan Murdoch
• [R] Change language in Rcmdr   Philippe Grosjean
• [R] Change language in Rcmdr   John Fox
• [R] Change language in Rcmdr   Adrian Dusa
• [R] Change legend in the 'hydrogeo' package   Tomas Lanczos
• [R] Change name of a specific column of a data frame   naw3 at duke.edu
• [R] Change name of a specific column of a data frame   jim holtman
• [R] Change name of a specific column of a data frame   Philip Twumasi-Ankrah
• [R] Chi-square parameter estimation   Julio Rojas
• [R] Chi-square parameter estimation   Moshe Olshansky
• [R] childNames for xaxis grob (grid package)   Tobias Verbeke
• [R] childNames for xaxis grob (grid package)   Paul Murrell
• [R] childNames for xaxis grob (grid package)   Tobias Verbeke
• [R] Coarsening the Resolution of a Dataset   Steve Murray
• [R] Coarsening the Resolution of a Dataset   jim holtman
• [R] Coarsening the Resolution of a Dataset   Steve Murray
• [R] Coarsening the Resolution of a Dataset   jim holtman
• [R] Coarsening the Resolution of a Dataset   Steve Murray
• [R] Coarsening the Resolution of a Dataset   Steve Murray
• [R] Coarsening the Resolution of a Dataset   jim holtman
• [R] Coarsening the Resolution of a Dataset   Steve Murray
• [R] Coconut benchmark for R?   Imanpreet
• [R] Coconut benchmark for R?   Hans W. Borchers
• [R] Coda not providing summary on mcmc object   Ben Bolker
• [R] code reduction (if anyone feels like it)   stephen sefick
• [R] code reduction (if anyone feels like it)   jim holtman
• [R] code reduction (if anyone feels like it)   stephen sefick
• [R] code reduction (if anyone feels like it)   jim holtman
• [R] code reduction (if anyone feels like it)   jim holtman
• [R] code reduction (if anyone feels like it)   stephen sefick
• [R] Code to calculate internal rate of return   Thomas E
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Tim Hesterberg
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Michal Figurski
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Frank E Harrell Jr
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Michal Figurski
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Gad Abraham
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Frank E Harrell Jr
• [R] Coefficients of Logistic Regression from bootstrap - how   (Ted Harding)
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Johannes Huesing
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Doran, Harold
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Doran, Harold
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Doran, Harold
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Bert Gunter
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Doran, Harold
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Rolf Turner
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   刘杰
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Doran, Harold
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   N. Lapidus
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Michal J. Figurski
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Gustaf Rydevik
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Gustaf Rydevik
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Gustaf Rydevik
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Frank E Harrell Jr
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Bert Gunter
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   John Kane
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Gustaf Rydevik
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Michal Figurski
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Frank E Harrell Jr
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Michal Figurski
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Frank E Harrell Jr
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Michal Figurski
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Michal Figurski
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Marc Schwartz
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Michal Figurski
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Frank E Harrell Jr
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Frank E Harrell Jr
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Mark Difford
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Michal Figurski
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Greg Snow
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Michal Figurski
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Michal Figurski
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Michal Figurski
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Mark Difford
• [R] Coefficients of Logistic Regression from bootstrap - how to get them?   Michal Figurski
• [R] cohort sampling   Terry Therneau
• [R] coin package (conditional inference / permutation): parameter teststat   Paulo Barata
• [R] colnames from read.table   Chua Siang Li
• [R] colnames from read.table   Erik Iverson
• [R] Color of box frame in Legend (Was: Matrix barplot)   Andreas Tille
• [R] Color of box frame in Legend (Was: Matrix barplot)   Andreas Tille
• [R] Color of box frame in Legend (Was: Matrix barplot)   Andreas Tille
• [R] Color of box frame in Legend (Was: Matrix barplot)   Nutter, Benjamin
• [R] Color of box frame in Legend (Was: Matrix barplot)   Prof Brian Ripley
• [R] color with tcl/tk?   Hua Li
• [R] Colors in Sweave   Stephen Tucker
• [R] Colors in Sweave   Duncan Murdoch
• [R] Colour clusters in a 2d plot   Josep Maria Campanera Alsina
• [R] Colour clusters in a 2d plot   Jorge Ivan Velez
• [R] Colour clusters in a 2d plot   hadley wickham
• [R] Colours in R   Leandro Marino
• [R] Colours in R   Duncan Murdoch
• [R] Colours in R   Earl F. Glynn
• [R] column wise paste of data.frames   Sebastian Weber
• [R] column wise paste of data.frames   Dimitris Rizopoulos
• [R] column wise paste of data.frames   Patrick Burns
• [R] combinations with replications   MarinaTarantini
• [R] combinations with replications   Jim Lemon
• [R] combinations with replications   ONKELINX, Thierry
• [R] Combining 4th column from 30 files   Daren Tan
• [R] Combining 4th column from 30 files   Henrique Dallazuanna
• [R] Combining 4th column from 30 files   Henrik Bengtsson
• [R] combining lists of pairs   olvrmrs at aol.com
• [R] combining lists of pairs   Charles C. Berry
• [R] Combining playwith with par(mfrow... ) i.e., multiple plots.   Vorlow Constantinos
• [R] combining time series [was: (no subject)]   Gabor Grothendieck
• [R] combining time series [was: (no subject)]   Gabor Grothendieck
• [R] combining zoo series with an overlapping index?   stephen sefick
• [R] combining zoo series with an overlapping index?   Gabor Grothendieck
• [R] combining zoo series with an overlapping index?   stephen sefick
• [R] combining zoo series with an overlapping index?   Gabor Grothendieck
• [R] combining zoo series with an overlapping index?   stephen sefick
• [R] combining zoo series with an overlapping index?   stephen sefick
• [R] Comparing complex numbers   David Stoffer
• [R] Comparing complex numbers   Duncan Murdoch
• [R] Comparing complex numbers   David Stoffer
• [R] Comparing differences in AUC from 2 different models   Monica Pisica
• [R] Comparing differences in AUC from 2 different models   Frank E Harrell Jr
• [R] competing risk model with time dependent covariates   phguardiol at aol.com
• [R] competing risk model with time dependent covariates under R or Splus   BXC (Bendix Carstensen)
• [R] compiling pnmath on an intel processor running mac OS 10.5   Mike Lawrence
• [R] compiling pnmath on an intel processor running mac OS 10.5   Luke Tierney
• [R] Complex to polar?   rkevinburton at charter.net
• [R] Complex to polar?   Prof Brian Ripley
• [R] Computing row means for sets of 2 columns   Daren Tan
• [R] Computing row means for sets of 2 columns   Henrik Bengtsson
• [R] Computing row means for sets of 2 columns   Daren Tan
• [R] Conditionally Updating Lattice Plots   Bryan Hanson
• [R] Conditionally Updating Lattice Plots   Gabor Grothendieck
• [R] Conditionally Updating Lattice Plots   Deepayan Sarkar
• [R] Confidence bands for model estimates using ns() spline basis   Assaf oron
• [R] confusion matrix in randomForest   Miklos Kiss
• [R] confusion matrix in randomForest   Liaw, Andy
• [R] Connecting R to PostgreSQL on Windows.   Andre Cesta
• [R] Constrained coefficients in lm   Jorge Ivan Velez
• [R] Constrained coefficients in lm (correction)   Jorge Ivan Velez
• [R] Constrained coefficients in lm (correction)   Horace Tso
• [R] Constrained coefficients in lm (correction)   Moshe Olshansky
• [R] Constrained optimization   Kanak Choudhury
• [R] Constrained optimization   Paul Smith
• [R] Control parameter of the optim( ): parscale   Zornitsa Luleva
• [R] Control parameter of the optim( ): parscale   Ben Bolker
• [R] conversion of data for use within barchart   Karin Lagesen
• [R] conversion of data for use within barchart   Deepayan Sarkar
• [R] convert a vector of words into a matrix   Daren Tan
• [R] convert a vector of words into a matrix   Patrick Burns
• [R] convert a vector of words into a matrix   Daren Tan
• [R] convert a vector of words into a matrix   Wacek Kusnierczyk
• [R] convert a vector of words into a matrix   Wacek Kusnierczyk
• [R] convert a vector of words into a matrix   Henrique Dallazuanna
• [R] Convert data set to data frame   Willa Wei
• [R] Convert data set to data frame   jim holtman
• [R] Convert data set to data frame   Jim Lemon
• [R] Convert list of lists <--> data frame   Michael Friendly
• [R] Convert list of lists <--> data frame   Henrique Dallazuanna
• [R] Convert list of lists <--> data frame   Marc Schwartz
• [R] Convert list of lists <--> data frame   N. Lapidus
• [R] Convert list of lists <--> data frame   Patrizio Frederic
• [R] Convert list of lists <--> data frame   Ben Bolker
• [R] Convert list of lists <--> data frame   Jorge Ivan Velez
• [R] Convert list of lists <--> data frame   Marc Schwartz
• [R] Convert list of lists <--> data frame   Henrique Dallazuanna
• [R] Converting english words to numeric equivalents   oscar Linares
• [R] Converting english words to numeric equivalents   Rolf Turner
• [R] Converting english words to numeric equivalents   Barry Rowlingson
• [R] Converting english words to numeric equivalents   baptiste auguie
• [R] Converting english words to numeric equivalents   (Ted Harding)
• [R] Converting english words to numeric equivalents   baptiste auguie
• [R] Converting english words to numeric equivalents   Hans-Joerg Bibiko
• [R] Converting english words to numeric equivalents   Hans-Joerg Bibiko
• [R] Converting from char to POSIX:   Agustin Lobo
• [R] Converting from char to POSIX:   Prof Brian Ripley
• [R] Converting to subscripts and superscripts   naw3 at duke.edu
• [R] Converting to subscripts and superscripts   Ben Bolker
• [R] copy number estimation through oligo package?   Yupu Liang
• [R] correction to small typo: How do I paste double quotes arround a character string?   Philip James Smith
• [R] Correction: RStat version 2.7.*1* now available   Gregory Warnes
• [R] correlation between matrices - both with some NAs   rcoder
• [R] Correlation structures in gls with repeated measurements   t03eh7 at abdn.ac.uk
• [R] Correlation structures in gls with repeated measurements   ONKELINX, Thierry
• [R] Correlation structures in gls with repeated measurements   t03eh7 at abdn.ac.uk
• [R] counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"   Daren Tan
• [R] counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"   Ken Knoblauch
• [R] counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"   Henrik Bengtsson
• [R] counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"   Wolfgang Huber
• [R] counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"   Patrick Aboyoun
• [R] counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"   Riley, Steve
• [R] create a function from a model   jp d
• [R] create a zero matrix & fill   mysimbaa
• [R] create a zero matrix & fill   jim holtman
• [R] Create an R package   FScottDahlgren
• [R] Create an R package   Gabor Grothendieck
• [R] Create an R package   FScottDahlgren
• [R] create multi windows plot at the same time   Alessandro
• [R] create multi windows plot at the same time   ctu at bigred.unl.edu
• [R] create multi windows plot at the same time   stephen sefick
• [R] creating axis of the plot before data are plotted   Zroutik Zroutik
• [R] creating axis of the plot before data are plotted   stephen sefick
• [R] creating axis of the plot before data are plotted   Zroutik Zroutik
• [R] creating axis of the plot before data are plotted   stephen sefick
• [R] creating axis of the plot before data are plotted -- solved   Zroutik Zroutik
• [R] creating names for lists   tolga.i.uzuner at jpmorgan.com
• [R] creating names for lists   Henrique Dallazuanna
• [R] creating names for lists   tolga.i.uzuner at jpmorgan.com
• [R] Creation of png=problems   Romain
• [R] Creation of png=problems   Richard Pearson
• [R] Creation of png=problems   Prof Brian Ripley
• [R] Cross correlation significance test   Nora Hanson
• [R] Cross correlation significance test   Nora Hanson
• [R] cross-validation in rpart   Sam Stewart
• [R] cross-validation in rpart   Terry Therneau
• [R] curva PI   Bruno P Masi
• [R] cutting out numbers from vectors   calundergrad
• [R] cutting out numbers from vectors   calundergrad
• [R] Data length mismatch.   rkevinburton at charter.net
• [R] Data length mismatch.   Gabor Grothendieck
• [R] Data length mismatch.   Gabor Grothendieck
• [R] Data length mismatch.   Gabor Grothendieck
• [R] Data length mismatch.   Gabor Grothendieck
• [R] Data length mismatch.   Gabor Grothendieck
• [R] Data length mismatch.   Don MacQueen
• [R] Data Manipulations and SQL   Willa Wei
• [R] Data Manipulations and SQL   Gabor Grothendieck
• [R] Data size   arghya ganguli
• [R] Data size   John Kane
• [R] data summarization etc...   sj
• [R] data summarization etc...   Daniel Malter
• [R] data summarization etc...   Daniel Malter
• [R] data summerization etc...   sj
• [R] data summerization etc...   ajay ohri
• [R] data summerization etc...   hadley wickham
• [R] data summerization etc...   Gabor Grothendieck
• [R] data transformation   Christian Hof
• [R] data transformation   Marc Schwartz
• [R] dataedit   Stephen Kennedy
• [R] date to decimal date conversion   Yogesh Tiwari
• [R] date to decimal date conversion   Gabor Grothendieck
• [R] deblur microscope image stacks   Darren Weber
• [R] Decoding subscripts/superscripts from CSVs   naw3 at duke.edu
• [R] Decoding subscripts/superscripts from CSVs   Mark Difford
• [R] Decoding subscripts/superscripts from CSVs   Jim Lemon
• [R] determing font type in expression   Thomas Hoffmann
• [R] determing font type in expression   Prof Brian Ripley
• [R] dev.off() inside a function & other glitches   Michael Hopkins
• [R] dev.off() inside a function & other glitches   Duncan Murdoch
• [R] dev.off() inside a function & other glitches   Deepayan Sarkar
• [R] dev.off() inside a function & other glitches   jim holtman
• [R] dev.off() inside a function & other glitches   Michael Hopkins
• [R] dev2bitmap error, 'gs' cannot be found   Boel Brynedal
• [R] dev2bitmap error, 'gs' cannot be found   Prof Brian Ripley
• [R] dgamma in WinBUGS and JAGS (rjags)   Seyed Reza Jafarzadeh
• [R] Different Autocorrelation using R and other softwares   Yinny
• [R] Different Autocorrelation using R and other softwares   Prof Brian Ripley
• [R] Difficultes with grep   Fran100681
• [R] Difficultes with grep   jim holtman
• [R] Difficultes with grep   Fran100681
• [R] Difficultes with grep   Charles C. Berry
• [R] Difficultes with grep   jim holtman
• [R] Difficultes with grep   Fran100681
• [R] discrete event simulation - "factory" with rework   seanpor
• [R] Discretize continous variables....   milicic.marko
• [R] Discretize continous variables....   Frank E Harrell Jr
• [R] Discretize continous variables....   Daniel Malter
• [R] Discretize continous variables....   Frank E Harrell Jr
• [R] Discretize continous variables....   Daniel Malter
• [R] Discretize continous variables....   Frank E Harrell Jr
• [R] Discretize continous variables....   milicic.marko
• [R] Discretize continous variables....   Johannes Huesing
• [R] Discretize continous variables....   Frank E Harrell Jr
• [R] Discretize continous variables....   Frank E Harrell Jr
• [R] Discretize continous variables....   Johannes Huesing
• [R] Discretize continous variables....   Frank E Harrell Jr
• [R] Display variables when running a script   naw3 at duke.edu
• [R] Display variables when running a script   jim holtman
• [R] Display variables when running a script   Stephan Kolassa
• [R] Display variables when running a script   Erik Iverson
• [R] Dividing by 0   nmarti
• [R] Dividing by 0   Robert Baer
• [R] Dividing by 0   Rolf Turner
• [R] Dividing by 0   Jim Lemon
• [R] Dividing by 0   nmarti
• [R] Dividing by 0   Roland Rau
• [R] Dividing by 0   Patrick Burns
• [R] Dividing by 0   John Maindonald
• [R] dll problem   stephenb
• [R] dll problem   Prof Brian Ripley
• [R] DOE for logistic models   Jeremy MAZET
• [R] Does R have SQL interface in windows?   rlearner309
• [R] Does R have SQL interface in windows?   Gabor Grothendieck
• [R] Does R have SQL interface in windows?   Prof Brian Ripley
• [R] dotFirst option   Ferry
• [R] dotFirst option   Rolf Turner
• [R] dput vs unclass to see what a factor really is composed of   Jacob Wegelin
• [R] Drawing a colour wheel - bug in hcl?   hadley wickham
• [R] Drawing a colour wheel - bug in hcl?   Earl F. Glynn
• [R] Drawing a colour wheel - bug in hcl?   hadley wickham
• [R] Drawing a colour wheel - bug in hcl?   Earl F. Glynn
• [R] Drawing a colour wheel - bug in hcl?   Achim Zeileis
• [R] Drawing a colour wheel - bug in hcl?   hadley wickham
• [R] Drawing a colour wheel - bug in hcl?   hadley wickham
• [R] Drawing a colour wheel - bug in hcl?   Achim Zeileis
• [R] drawing segments through points with pch=1   David Epstein
• [R] drawing segments through points with pch=1   Paul Smith
• [R] drawing segments through points with pch=1   Uwe Ligges
• [R] drawing segments through points with pch=1   Prof Brian Ripley
• [R] drawing segments through points with pch=1   David Epstein
• [R] drawing segments through points with pch=1   Jim Lemon
• [R] drawing segments through points with pch=1   Martin Maechler
• [R] drawing segments through points with pch=1   Paulo Barata
• [R] drawing segments through points with pch=1   Mike Prager
• [R] Eclipse/Statet: How to set breakpoints   el_eli at gmx.de
• [R] Eclipse/Statet: How to set breakpoints   Duncan Murdoch
• [R] Eclipse/Statet: How to set breakpoints   Duncan Murdoch
• [R] Editor for Mac   Angelo Scozzarella
• [R] Editor for Mac   Shige Song
• [R] Editor for Mac   Hans-Peter Suter
• [R] Editor for Mac   stephen sefick
• [R] Editor fpr Mac OS   Angelo Scozzarella
• [R] Editor fpr Mac OS   Hans W. Borchers
• [R] Editor fpr Mac OS   Don MacQueen
• [R] Editor fpr Mac OS   Rolf Turner
• [R] Ellipsis arguments for plot.formula   Amit Ganatra
• [R] Ellipsis arguments for plot.formula   Bert Gunter
• [R] Ellipsis arguments for plot.formula   Amit Ganatra
• [R] Ellipsis arguments for plot.formula   Gabor Grothendieck
• [R] Ellipsis arguments for plot.formula   Amit Ganatra
• [R] Ellipsis arguments for plot.formula   Gabor Grothendieck
• [R] Ellipsis arguments for plot.formula   Amit Ganatra
• [R] embarrassingly parallel problem - simple loop solution   Chris Gaiteri
• [R] embarrassingly parallel problem - simple loop solution   Martin Morgan
• [R] enscript states file for R scripts?   cmr.Pent at gmail.com
• [R] enscript states file for R scripts?   hadley wickham
• [R] enscript states file for R scripts?   cmr.Pent at gmail.com
• [R] enscript states file for R scripts?   Dirk Eddelbuettel
• [R] enscript states file for R scripts?   Peter Dalgaard
• [R] enumerate subsets   lamack lamack
• [R] enumerate subsets   jim holtman
• [R] enumerate subsets   Peter Dalgaard
• [R] enumerate subsets   Gabor Grothendieck
• [R] environment question   Edna Bell
• [R] environment question   Jeffrey Horner
• [R] Equation sequencing   Stuart Nettleton
• [R] equivalent R functions for Numerical Recipes fitxy and fitexy ?   Liaw, Andy
• [R] equivalent R functions for Numerical Recipes fitxy and fitexy ?   Marc Fischer
• [R] equivalent R functions for Numerical Recipes fitxy and fitexy ?   Marc Fischer
• [R] Erro updating HTML package descriptions in packages.html   José Augusto Jr.
• [R] Erro updating HTML package descriptions in packages.html   Uwe Ligges
• [R] Erro updating HTML package descriptions in packages.html   Gabor Grothendieck
• [R] Erro updating HTML package descriptions in packages.html   José Augusto Jr.
• [R] Erro updating HTML package descriptions in packages.html   Gabor Grothendieck
• [R] Erro: cannot allocate vector of size 216.0 Mb   José Augusto Jr.
• [R] Erro: cannot allocate vector of size 216.0 Mb   jim holtman
• [R] Erro: cannot allocate vector of size 216.0 Mb   Uwe Ligges
• [R] Erro: cannot allocate vector of size 216.0 Mb   Prof Brian Ripley
• [R] Erro: cannot allocate vector of size 216.0 Mb   José Augusto Jr.
• [R] Erro: cannot allocate vector of size 216.0 Mb   José Augusto Jr.
• [R] Erro: cannot allocate vector of size 216.0 Mb   Rolf Turner
• [R] Erro: cannot allocate vector of size 216.0 Mb   José Augusto Jr.
• [R] Erro: cannot allocate vector of size 216.0 Mb   Rolf Turner
• [R] Error - unable to load shared library   Youngik Yang
• [R] Error - unable to load shared library   Prof Brian Ripley
• [R] Error in defining function   Megh Dal
• [R] Error in defining function   Gabor Grothendieck
• [R] Error in defining function   Megh Dal
• [R] Error in defining function   Gabor Grothendieck
• [R] Error in defining function   Megh Dal
• [R] Error in defining function   Gabor Grothendieck
• [R] Error in edit(name,file,title,editor)   David Epstein
• [R] Error in edit(name,file,title,editor)   jim holtman
• [R] Error in edit(name,file,title,editor)   David Epstein
• [R] Error in installing packages   Lazarus Mramba
• [R] Error in installing packages   Richard Pearson
• [R] Error in installing packages   Ben Bolker
• [R] Error in installing packages   Gabor Grothendieck
• [R] error in test   Paul Adams
• [R] error in test   jim holtman
• [R] Error in vector("double", length)   Kumudan
• [R] Error of exp() in a dll from Fortran   Hao Ren Sr
• [R] Error of exp() in a dll from Fortran   Duncan Murdoch
• [R] error on predict   Michele Santacatterina
• [R] create a zero matrix & fill   mysimbaa
• [R] error with .dll file and RGtk2   paulandpen
• [R] error with .dll file and RGtk2   Prof Brian Ripley
• [R] error with .dll file and RGtk2   Michael Lawrence
• [R] Error: cannot use PQL when using lmer   hpdutra at yahoo.com
• [R] Error: cannot use PQL when using lmer   Ben Bolker
• [R] Error: cannot use PQL when using lmer   hpdutra at yahoo.com
• [R] Error: cannot use PQL when using lmer   hpdutra
• [R] errors using step function   silvia narduzzi
• [R] errors using step function   silvia narduzzi
• [R] Errror in running R2.7.1 version to R2.6.2 version   Lazarus Mramba
• [R] estimating volume from xyz points   milton ruser
• [R] estimating volume from xyz points   Gabor Grothendieck
• [R] eval.wih.vis   mysimbaa
• [R] eval.wih.vis   mysimbaa
• [R] Excel Trend Function   Felipe Carrillo
• [R] Excel Trend Function   Daniel Malter
• [R] Excel Trend Function   paulandpen
• [R] Excel Trend Function   Daniel Malter
• [R] Exception Handling   Tudor Bodea
• [R] Exception Handling   jim holtman
• [R] Exception Handling   Paul Gilbert
• [R] experimental semivariogram   Alessandro
• [R] experimental semivariogram   ONKELINX, Thierry
• [R] Exporting a Graph that has lines()   R_Learner
• [R] Exporting a Graph that has lines()   Peter Dalgaard
• [R] Exporting a Graph that has lines()   R_Learner
• [R] Exporting a Graph that has lines()   Peter Dalgaard
• [R] Exporting an list()   Leandro Marino
• [R] Exporting an list()   Henrique Dallazuanna
• [R] Exporting an list()   Jorge Ivan Velez
• [R] Exporting an list()   Jim Lemon
• [R] exporting ftable   Leandro Marino
• [R] exporting ftable   Henrique Dallazuanna
• [R] Expression in axis   Dani Valverde
• [R] Expression in axis   Daniel Malter
• [R] Expression in axis   Gabor Csardi
• [R] Expression in axis   Daniel Malter
• [R] Expression in axis   S Ellison
• [R] Extract and plot array from data   theBenjamin
• [R] extracting colnames to label plots in a function   stephen sefick
• [R] extracting colnames to label plots in a function   Gabor Grothendieck
• [R] extracting colnames to label plots in a function   stephen sefick
• [R] extracting colnames to label plots in a function   stephen sefick
• [R] extracting colnames to label plots in a function   stephen sefick
• [R] extracting colnames to label plots in a function   Gabor Grothendieck
• [R] extracting elements from a list in vectorized form   jgarcia at ija.csic.es
• [R] extracting elements from a list in vectorized form   Peter Dalgaard
• [R] extracting elements from a list in vectorized form   jgarcia at ija.csic.es
• [R] extracting elements from print object of Manova()   Michael Rennie
• [R] extracting elements from print object of Manova()   Jorge Ivan Velez
• [R] extracting elements from print object of Manova()   Michael Friendly
• [R] extracting index list when using tapply()   hesicaia
• [R] extracting index list when using tapply()   ctu at bigred.unl.edu
• [R] extracting index list when using tapply()   Charles C. Berry
• [R] extracting index list when using tapply()   jim holtman
• [R] extracting index list when using tapply()   hesicaia
• [R] extracting Pr>ltl from robcov/ols (Design)   ldb
• [R] extracting Pr>ltl from robcov/ols (Design)   Mark Difford
• [R] extracting Pr>ltl from robcov/ols (Design)   Frank E Harrell Jr
• [R] Extracting regression coef. and p-values in JRClient   Amine Mohamed ROUANE HACENE
• [R] Extracting regression coef. and p-values in JRClient   Amine Mohamed ROUANE HACENE
• [R] extracting values from a "by" function   Daniel Stahl
• [R] F test   Vicki Meng
• [R] F test   Peter Dalgaard
• [R] F test   Vicki Meng
• [R] F test   Peter Dalgaard
• [R] factor question   Edna Bell
• [R] factor question   Henrique Dallazuanna
• [R] factor question   Mark Difford
• [R] false discovery rate !   A Ezhil
• [R] false discovery rate !   john seers (IFR)
• [R] false discovery rate !   john seers (IFR)
• [R] fama-macbeth   Denise Xifara
• [R] fama-macbeth   Denise Xifara
• [R] fastICA   Mikhail Spivakov
• [R] FFT - (STATS) - is this correct?   renata.camargo05 at ntlworld.com
• [R] FFT - (STATS) - is this correct?   Rolf Turner
• [R] FFT - (STATS) - is this correct?   stephen sefick
• [R] fill in area between 2 lines with a color   David Freedman
• [R] fill in area between 2 lines with a color   Dimitris Rizopoulos
• [R] fill in area between 2 lines with a color   Marc Schwartz
• [R] Fill in NA values in vector with previous character/factor   Owen Jones
• [R] Fill in NA values in vector with previous character/factor   Gabor Grothendieck
• [R] Fill in NA values in vector with previous character/factor   Dimitris Rizopoulos
• [R] Fill in NA values in vector with previous character/factor   Yasir Kaheil
• [R] Fill in NA values in vector with previous character/factor   Bert Gunter
• [R] Fill in NA values in vector with previous character/factor   Christos Hatzis
• [R] Filtering output   rkevinburton at charter.net
• [R] Filtering output   jim holtman
• [R] Find classes of each column of data.frame()   Dong-hyun Oh
• [R] Find classes of each column of data.frame()   Henrique Dallazuanna
• [R] Find classes of each column of data.frame()   Gabor Csardi
• [R] Find classes of each column of data.frame()   Dong-hyun Oh
• [R] Find classes of each column of data.frame()   Dong-hyun Oh
• [R] Find classes of each column of data.frame()   Wacek Kusnierczyk
• [R] Find the closest value in a list or matrix   R_Learner
• [R] Find the closest value in a list or matrix   Henrique Dallazuanna
• [R] Find the closest value in a list or matrix   Daniel Malter
• [R] Find the closest value in a list or matrix   Tobias Verbeke
• [R] Find the closest value in a list or matrix   Jorge Ivan Velez
• [R] finding "chuncks" of data that have no NA s   stephen sefick
• [R] finding "chuncks" of data that have no NA s   Gabor Grothendieck
• [R] finding "chuncks" of data that have no NA s   stephen sefick
• [R] finding "chuncks" of data that have no NA s   Gabor Grothendieck
• [R] finding "chuncks" of data that have no NA s   stephen sefick
• [R] finding a faster way to do an iterative computation   dxc13
• [R] finding a faster way to do an iterative computation   Rolf Turner
• [R] finding a faster way to do an iterative computation   Christos Hatzis
• [R] finding a faster way to do an iterative computation   Moshe Olshansky
• [R] finding a faster way to do an iterative computation   dxc13
• [R] Finding Values that Occur Most Often in a Vector   Gundala Viswanath
• [R] Finding Values that Occur Most Often in a Vector   hpages at fhcrc.org
• [R] Finding Values that Occur Most Often in a Vector   Duncan Mackay
• [R] First attempt to use R   Ted
• [R] First attempt to use R   Roland Rau
• [R] First attempt to use R   Gabor Grothendieck
• [R] fisher.test   Marta Colombo
• [R] fisher.test   Marta Colombo
• [R] Fit a 3-Dimensional Line to Data Points   S. M. Niaz Arifin
• [R] Fit a 3-Dimensional Line to Data Points   Richard.Cotton at hsl.gov.uk
• [R] Fit a 3-Dimensional Line to Data Points   Prof Brian Ripley
• [R] Fit a 3-Dimensional Line to Data Points   Hans W. Borchers
• [R] fit.dist gnlm question, NaN and Inf results   Richard and Barbara Males
• [R] Fitting a Bivariate Poisson log-normal distribution   Famoye, Felix
• [R] Fitting a curve to data   Shirin Safa
• [R] Fitting a curve to data   stephen sefick
• [R] Fitting a curve to data   Shirin Safa
• [R] Fitting a curve to data   stephen sefick
• [R] Fitting a curve to data   Carl Witthoft
• [R] Fitting a curve to data   stephen sefick
• [R] Fitting a curve to data   Gabor Grothendieck
• [R] Fitting a curve to data   Carl Witthoft
• [R] Fitting a curve to data   Vikas Rawal
• [R] Fitting a curve to data   Greg Snow
• [R] fixed effect significance with lmer() vs. t-test   dej500 at york.ac.uk
• [R] Flexible semivariogram in R (HELP)   Alessandro
• [R] Flip Matrix form file?   Chris82
• [R] Flip Matrix form file?   Henrik Bengtsson
• [R] Flip Matrix form file?   Chris82
• [R] float and double precision with C code   JS Ubei
• [R] float and double precision with C code   jim holtman
• [R] flow map lines between point pairs (latitude/longitude)   Richard and Barbara Males
• [R] flow map lines between point pairs (latitude/longitude)   Ray Brownrigg
• [R] flow map lines between point pairs (latitude/longitude)   Richard and Barbara Males
• [R] Font quality in base graphics   willemf
• [R] Font quality in base graphics   Jeffrey Horner
• [R] Font quality in base graphics   willemf
• [R] Font quality in base graphics   Mark Difford
• [R] Font quality in base graphics   Mike Prager
• [R] Font quality in base graphics   willemf
• [R] Font quality in base graphics   Mark Difford
• [R] Font quality in base graphics   Mark Difford
• [R] Font quality in base graphics   Gabor Csardi
• [R] Font quality in base graphics   Gabor Csardi
• [R] For loop   laila khalfan
• [R] For loop   laila khalfan
• [R] forecast & xreg   Vorlow Constantinos
• [R] Forecasting enrollments with fuzzy time series   Kate
• [R] forget my previous question   markleeds at verizon.net
• [R] Formatting Syntax when Merging   Jia Ying Mei
• [R] Formatting Syntax when Merging   Gabor Grothendieck
• [R] FOURIER TRANSFORM HELP   renata.camargo05 at ntlworld.com
• [R] Frequency-Table on Group Level - Multi Level Analysis   Kunzler, Andreas
• [R] ftp directory   Yuri Volchik
• [R] function "eigen" AND Minitab   SH.Chou
• [R] function "eigen" AND Minitab   Bill.Venables at csiro.au
• [R] function "eigen" AND Minitab   Patrick Burns
• [R] Function Error   Angelo Scozzarella
• [R] Function Error   Erik Iverson
• [R] Function Error   Sarah Goslee
• [R] Function Error   Barry Rowlingson
• [R] Function Error   anna freni sterrantino
• [R] Function to create variables with prefix   Moira Burke
• [R] Function to create variables with prefix   Uwe Ligges
• [R] Function to create variables with prefix   Moira Burke
• [R] Function to create variables with prefix   jim holtman
• [R] function to transform response of a formula   Paul Emberson
• [R] function to transform response of a formula   email at calidasoft.co.uk
• [R] function to transform response of a formula   Paul Emberson
• [R] Function to verify existence of an R object   Judith Flores
• [R] Function to verify existence of an R object   Bert Gunter
• [R] Function to verify existence of an R object   Duncan Murdoch
• [R] Function to verify existence of an R object   Earl F. Glynn
• [R] Functions similar to step() and all.effects() that work for lme() objects?   Jon Zadra
• [R] Functions similar to step() and all.effects() that work for lme() objects?   Christoph Scherber
• [R] Functions similar to step() and all.effects() that work for lme() objects?   Prof Brian Ripley
• [R] Funnel plots   Januarius
• [R] Funnel plots in r   Januarius
• [R] FW: average replicate probe values   Kaposi-Novak, Pal
• [R] Fw: Using if, else statements   Gabriela Cendoya
• [R] FW: average replicate probe values   jim holtman
• [R] FW: For loop   laila khalfan
• [R] Fw: how i can install Rgraphviz in R2.7.1   haani hanni
• [R] Fw: how i can install Rgraphviz in R2.7.1   Uwe Ligges
• [R] Fw: how i can install Rgraphviz in R2.7.1   haani hanni
• [R] Fw: how i can install Rgraphviz in R2.7.1   Duncan Murdoch
• [R] Fw: how i can install Rgraphviz in R2.7.1   Martin Morgan
• [R] FW: Installing BRugs   BXC (Bendix Carstensen)
• [R] FW: Installing BRugs   Uwe Ligges
• [R] FW: Installing BRugs   Prof Brian Ripley
• [R] FW: RES: bug in axis.Date? was (Re: newbie needs help plottingtimeseries)   Kurapati, Ravichandra (Ravichandra)
• [R] Fwd: Re: extracting index list when using tapply()   ctu at bigred.unl.edu
• [R] Gage R & R   Isabella Ghement
• [R] gam() of package "mgcv" and anova()   Kunio takezawa
• [R] garchFit problem   Shirin Safa
• [R] generalized spatial autoregressive lag model   De Tuimelaar
• [R] generate repeats of a vector's elements   Chaofeng Kou
• [R] generate repeats of a vector's elements   Antje
• [R] generate repeats of a vector's elements   Dimitris Rizopoulos
• [R] Generic plot function for GLM objects   Beat Huggler
• [R] get formatted regression output   Bunny, lautloscrew.com
• [R] get formatted regression output   Abhijit Dasgupta
• [R] get formatted regression output   Jim Lemon
• [R] Getting plot axes where they should be!   (Ted Harding)
• [R] Getting plot axes where they should be!   Marc Schwartz
• [R] Getting plot axes where they should be!   Duncan Murdoch
• [R] Getting plot axes where they should be!   (Ted Harding)
• [R] Getting plot axes where they should be!   (Ted Harding)
• [R] ggplot question   Williams Scott
• [R] ggplot question   hadley wickham
• [R] ggplot2 book?   hpdutra
• [R] ggplot2 help   Edna Bell
• [R] ggplot2 help   David Freedman
• [R] ggplot2 legend for vertical lines   baptiste Auguié
• [R] ggplot2 legend for vertical lines   hadley wickham
• [R] ggplot2: scaling and tick mark of x-axis   Henning Wildhagen
• [R] ggplot2: scaling and tick mark of x-axis   hadley wickham
• [R] glht after lmer with "$S4class-" and "missing model.matrix-" errors   Douglas Bates
• [R] glht after lmer with "$S4class-" and "missing model.matrix-" errors with DATA   Anna Radtke
• [R] glht after lmer with "$S4class-" and "missing model.matrix-" errors   Anna Radtke
• [R] glm error: factor levels   Birgitle
• [R] GLM, LMER, GEE interpretation   Daniel Malter
• [R] GLM, LMER, GEE interpretation   Ben Bolker
• [R] GLM, LMER, GEE interpretation   ctu at bigred.unl.edu
• [R] GLM, LMER, GEE interpretation   Daniel Malter
• [R] GLM, LMER, GEE interpretation   Ben Bolker
• [R] GLM, LMER, GEE interpretation   Daniel Malter
• [R] GLS "no terms component" error   mm745 at st-andrews.ac.uk
• [R] GLS "no terms component" error   Bill.Venables at csiro.au
• [R] GLS "no terms component" error   mm745 at st-andrews.ac.uk
• [R] Goodness of fit test   martin.gaston at unavarra.es
• [R] Graph   Marco Chiapello
• [R] Graph Order in xyplot   Sam Albers
• [R] Graph Order in xyplot   Gabor Grothendieck
• [R] Graph Order in xyplot   Deepayan Sarkar
• [R] Graph Order in xyplot   hippie dream
• [R] graph woes   Patrick Jackson
• [R] graph woes   Patrick Jackson
• [R] graph woes   Gabor Grothendieck
• [R] Graphics function question   Peter Flom
• [R] Graphics function question   Marc Schwartz
• [R] Graphics function question   Sarah Goslee
• [R] Graphics function question   Sarah Goslee
• [R] Graphics function question   Marc Schwartz
• [R] Graphics not working for R in ubuntu   Nataraj
• [R] Graphics not working for R in ubuntu   Mose Andre
• [R] Graphics not working for R in ubuntu   Michael Bibo
• [R] Graphics not working for R in ubuntu   Vincent Goulet
• [R] graphing regression coefficients and standard errors   Murali K
• [R] graphing regression coefficients and standard errors   Ritwik Sinha
• [R] graphing regression coefficients and standard errors   Mark Difford
• [R] Grid building in R   hippie dream
• [R] Grid building in R   hadley wickham
• [R] Grid building in R   Sam Albers
• [R] Grid building in R   Erik Iverson
• [R] Grid building in R   Sam Albers
• [R] Grid building in R   Dylan Beaudette
• [R] Grid building in R   Sam Albers
• [R] Grid building in R   Jim Lemon
• [R] Group level frequencies   Kunzler, Andreas
• [R] Group level frequencies   Dimitris Rizopoulos
• [R] Group level frequencies   jim holtman
• [R] GroupedData for three way randomized block. LME   hpdutra
• [R] gstat problem with lidar data   Alessandro
• [R] gstat problem with lidar data   Dylan Beaudette
• [R] gsub and "\"   Sean Davis
• [R] gsub and "\"   jim holtman
• [R] gsub and "\"   Sean Davis
• [R] gsub and "\"   (Ted Harding)
• [R] heatmap   Nair, Murlidharan T
• [R] heatmap   Nair, Murlidharan T
• [R] Hello,   Kiran Annaiah
• [R] help about random generation of a Normal distribution of several variables   Gavin Simpson
• [R] help about random generation of a Normal distribution ofseveral variables   Bill.Venables at csiro.au
• [R] help about random generation of a Normal distribution ofseveral variables   Bill.Venables at csiro.au
• [R] help about random generation of a Normal distribution of   (Ted Harding)
• [R] help about random generation of a Normal distribution of   (Ted Harding)
• [R] help about random generation of a Normal distribution of several variables   Arnau Mir Torres
• [R] help about random generation of a Normal distribution of several variables   Peng Jiang
• [R] help about random generation of a Normal distribution of several variables   Peng Jiang
• [R] help about random generation of a Normal distribution of several variables   Arnau Mir
• [R] help appreciated to make a plot   Zheng Lu
• [R] help appreciated to make a plot   Gabor Grothendieck
• [R] help appreciated to make a plot   Jim Lemon
• [R] help for xvalid with external data   Giovanni Bacaro
• [R] Help in using PCR   Jason Lee
• [R] Help in using PCR   Gavin Simpson
• [R] Help in using PCR   Bjørn-Helge Mevik
• [R] Help in using PCR   Jason Lee
• [R] Help in using PCR   Erik Iverson
• [R] Help in using PCR   Gavin Simpson
• [R] Help in using PCR   Bjørn-Helge Mevik
• [R] Help in using PCR   Gavin Simpson
• [R] Help in using PCR   Bjørn-Helge Mevik
• [R] Help interpreting density().   rkevinburton at charter.net
• [R] Help interpreting density().   Bill.Venables at csiro.au
• [R] Help interpreting density().   Mark Difford
• [R] Help interpreting density().   rkevinburton at charter.net
• [R] Help interpreting density().   rkevinburton at charter.net
• [R] Help interpreting density().   Mark Difford
• [R] Help interpreting density().   rkevinburton at charter.net
• [R] Help interpreting density().   Mark Difford
• [R] Help interpreting density().   Bill.Venables at csiro.au
• [R] Help navigating documentation for descriptive statistics   Ted
• [R] Help on Analysis of covariance   Partha
• [R] Help on Analysis of covariance   Chuck Cleland
• [R] Help on Installing Matrix Package in Linux (Fedora)   Hyunseung Kang
• [R] Help on Installing Matrix Package in Linux (Fedora)   Krzysztof Sakrejda-Leavitt
• [R] Help on Installing Matrix Package in Linux (Fedora)   Marc Schwartz
• [R] Help on Installing Matrix Package in Linux (Fedora)   Hyunseung Kang
• [R] help on list comparison   Rajasekaramya
• [R] help on list comparison   Jorge Ivan Velez
• [R] help on R benchmarks   Jiangtian Li
• [R] Help regarding arules package   Daniel Wagner
• [R] Help regarding arules package   jim holtman
• [R] Help to Text Windoes in Menu with TCL-TK   ermimi
• [R] Help Updating and Installing R Packages   Tariq Perwez
• [R] Help Updating and Installing R Packages   Vincent Goulet
• [R] Help with a loop   Sofia Martinez
• [R] Help with a loop   Patrick Burns
• [R] Help with a loop   Sofia Martinez
• [R] Help with an error message   naw3 at duke.edu
• [R] Help with an error message   stephen sefick
• [R] Help with arima.sim   Christopher Gürke
• [R] Help with arima.sim   Erin Hodgess
• [R] help with bivariate density plot question   Daniela Carollo
• [R] help with bivariate density plot question   Mark Difford
• [R] help with data layout   Iain Gallagher
• [R] help with data layout   Erik Iverson
• [R] help with data layout   Henrique Dallazuanna
• [R] help with data layout   Stephen Tucker
• [R] help with data layout   jim holtman
• [R] help with data layout   Mike Lawrence
• [R] Help with data layout - Thanks   Iain Gallagher
• [R] help with durbin.watson   tom soyer
• [R] help with durbin.watson   John Fox
• [R] Help with eigenvectors   Francisco Javier Santos Alamillos
• [R] Help with eigenvectors   Ben Bolker
• [R] Help with error in "if then" statement   Andrew Rominger
• [R] Help with error in "if then" statement   Erik Iverson
• [R] Help with error in "if then" statement   John Kane
• [R] Help with hazard plots   Alan Cox
• [R] Help with hazard plots   Alan Cox
• [R] Help with installing add-on packages   Miha Staut
• [R] Help with installing add-on packages   Miha Staut
• [R] help with integrate function   Brown, Andrew A
• [R] Help with maptools sunriset()   stephen sefick
• [R] Help with matrix   Van Wyk, Jaap
• [R] Help with matrix   jim holtman
• [R] Help with rearranging data   William Pepe
• [R] Help with rearranging data   Henrik Bengtsson
• [R] Help with rearranging data   jim holtman
• [R] Help with rearranging data   William Pepe
• [R] Help with rep   Van Wyk, Jaap
• [R] Help with rep   Peter Dalgaard
• [R] Help with rep   Gabor Csardi
• [R] Help with rep   Dimitris Rizopoulos
• [R] Help with rpart.predict?   L. Jay Roberts
• [R] help with simulate AR(1) data   cathelf
• [R] help with simulate AR(1) data   Rolf Turner
• [R] help with simulate AR(1) data   Peter Dalgaard
• [R] help with simulate AR(1) data   Rolf Turner
• [R] Help with which()   naw3 at duke.edu
• [R] Help with which()   Erik Iverson
• [R] Help with which()   Ben Bolker
• [R] Help with which()   (Ted Harding)
• [R] Help with which()   Erik Iverson
• [R] Help with which()   Ben Bolker
• [R] Help with yaImpute   Wesley Roberts
• [R] Hiding information about functions in newly developed packages   Peter Dalgaard
• [R] Hiding information about functions in newly developed packages   Bert Gunter
• [R] Hiding information about functions in newly developed packages   Marc Schwartz
• [R] Hiding information about functions in newly developed packages   Tudor Bodea
• [R] High resolution graphics from R Windows Vista   Adam Langley
• [R] High resolution graphics from R Windows Vista   Prof Brian Ripley
• [R] High resolution graphics from Windows Vista   Adam Langley
• [R] Histogram   Angelo Scozzarella
• [R] Histogram   milton ruser
• [R] Histogram   Henrique Dallazuanna
• [R] Histogram   milton ruser
• [R] Histogram   Mark Difford
• [R] Histogram   Vincent Goulet
• [R] histogram plot default   Xin
• [R] histogram plot default   jim holtman
• [R] Histogram with colors according to factor   Hans W. Borchers
• [R] Histogram with colors according to factor   ONKELINX, Thierry
• [R] Histogram with colors according to factor   Hans W. Borchers
• [R] Histogram with colors according to factor   ONKELINX, Thierry
• [R] Histogram with colors according to factor   hadley wickham
• [R] Histogram with two colors depending on condition   Mohammad Ehsanul Karim
• [R] Histogram with two colors depending on condition   jim holtman
• [R] Histogram with two colors depending on condition   hadley wickham
• [R] Histogram with two colors depending on condition   Greg Snow
• [R] History pruning   Ken Williams
• [R] History pruning   Marc Schwartz
• [R] History pruning   Ken Williams
• [R] History pruning   Marc Schwartz
• [R] History pruning   Ken Williams
• [R] History pruning   Duncan Murdoch
• [R] History pruning   Ken Williams
• [R] History pruning   hadley wickham
• [R] Hi~problem with the two sample test: ks2Test in the package of fbasics   lily
• [R] Hi~problem with the two sample test: ks2Test in the package of fbasics   l y
• [R] Hi~problem with the two sample test: ks2Test in the package of fbasics   Ben Bolker
• [R] Hmisc latex function with longtable option   Erik Iverson
• [R] Hmisc latex function with longtable option   Frank E Harrell Jr
• [R] Hmisc latex: table column width   Lauri Nikkinen
• [R] Hmisc latex: table column width   Lauri Nikkinen
• [R] How can i do an automatic upgrade of R 2.5.1 to R 2.7.1   Jason Lee
• [R] How can i do an automatic upgrade of R 2.5.1 to R 2.7.1   Jason Lee
• [R] How can i do an automatic upgrade of R 2.5.1 to R 2.7.1   Dirk Eddelbuettel
• [R] How can i do an automatic upgrade of R 2.5.1 to R 2.7.1   Paul Hiemstra
• [R] How can i do an automatic upgrade of R 2.5.1 to R 2.7.1   Paul Hiemstra
• [R] How can i do an automatic upgrade of R 2.5.1 to R 2.7.1   Paul Hiemstra
• [R] How can i do an automatic upgrade of R 2.5.1 to R 2.7.1   Thibaut Jombart
• [R] How can I optimize this piece of code ?   Daren Tan
• [R] How can I optimize this piece of code ?   ONKELINX, Thierry
• [R] how can I write code to detect whether the machine is Windows or Linux?   Rolf Turner
• [R] how can I write code to detect whether the machine is Windows or Linux?   Gabor Grothendieck
• [R] how can I write code to detect whether the machine is Windows or Linux?   Philip James Smith
• [R] how can I write code to detect whether the machine is Windows or Linux?   Marc Schwartz
• [R] how can I write code to detect whether the machine is Windows or Linux?   Peter Dalgaard
• [R] How do I install Joomla! 1.5?   Fido
• [R] How do I paste double quotes arround a character string?   Philip James Smith
• [R] How do I paste double quotes arround a character string?   Erik Iverson
• [R] How do I paste double quotes arround a character string?   (Ted Harding)
• [R] How do I paste double quotes arround a character string?   Philip James Smith
• [R] How do I paste double quotes arround a character string?   (Ted Harding)
• [R] How do I paste double quotes arround a character string?   Philip James Smith
• [R] How do I paste double quotes arround a character string?   Prof Brian Ripley
• [R] How do I paste double quotes arround a character string?   (Ted Harding)
• [R] How do I paste double quotes arround a character string?   Prof Brian Ripley
• [R] How do I paste double quotes arround a character string?   Philip James Smith
• [R] how do I read only specific columns using read.csv or other read function   Ben Tupper
• [R] how do I read only specific columns using read.csv or other read function   Juliet Hannah
• [R] how do I read only specific columns using read.csv or other read function   Philip James Smith
• [R] how do I read only specific columns using read.csv or other read function   Charles C. Berry
• [R] how do I read only specific columns using read.csv or other read function   Charles C. Berry
• [R] How I count the all possible samples??   muhammad faisal
• [R] How I count the all possible samples??   Jorge Ivan Velez
• [R] How I count the all possible samples??   John Kane
• [R] how know the status of particular process   Kurapati, Ravichandra (Ravichandra)
• [R] how know the status of particular process   Duncan Murdoch
• [R] how to add notes to the graph?   rlearner309
• [R] how to add notes to the graph?   Dieter Menne
• [R] how to add notes to the graph?   Jim Lemon
• [R] how to automatically maximize the graph window (under XP) ?   Ptit_Bleu
• [R] how to automatically maximize the graph window (under XP) ?   Ptit_Bleu
• [R] how to automatically maximize the graph window (under XP) ?   Prof Brian Ripley
• [R] How to build a package which loads Rgraphviz (if installed)...   Uwe Ligges
• [R] How to build a package which loads Rgraphviz (if installed)...   Duncan Murdoch
• [R] How to build a package which loads Rgraphviz (if installed)...   Søren Højsgaard
• [R] How to build a package which loads Rgraphviz (if installed)...   Søren Højsgaard
• [R] How to build a package which loads Rgraphviz (if installed)...   Søren Højsgaard
• [R] How to build a package which loads Rgraphviz (if installed)...   William Revelle
• [R] How to build a package which loads Rgraphviz (if installed)...   William Revelle
• [R] how to capture matching words in a string ?   Daren Tan
• [R] how to capture matching words in a string ?   Gabor Grothendieck
• [R] How to change labels in a histogram   Lord Yo
• [R] How to change labels in a histogram   Philipp Pagel
• [R] How to change labels in a histogram   S Ellison
• [R] How to check how much memory has been used or reserved ?   Daren Tan
• [R] How to compute loglikelihood of Lognormal distribution   Gundala Viswanath
• [R] How to control the memory?   rlearner309
• [R] How to convert/map jacktest results to dataframe or file   Jason Lee
• [R] how to correlate nominal variables?   Timo Stolz
• [R] how to correlate nominal variables?   Daniel Malter
• [R] How to cut data elements included in a text line   Christine A.
• [R] How to cut data elements included in a text line   Henrique Dallazuanna
• [R] How to cut data elements included in a text line   Jorge Ivan Velez
• [R] How to cut data elements included in a text line   Gabor Grothendieck
• [R] How to delete duplicate cases?   Daniel Wagner
• [R] How to delete duplicate cases?   Jorge Ivan Velez
• [R] How to delete duplicate cases?   Henrique Dallazuanna
• [R] How to delete duplicate cases?   Erik Iverson
• [R] How to delete duplicate cases?   Marc Schwartz
• [R] How to delete duplicate cases?   Patrizio Frederic
• [R] How to draw dot plots for 2 vectors seperately   ss
• [R] how to draw multiples curses (for given formulae) in lattice   John Smith
• [R] How to emulate perl style of reading files ?   Daren Tan
• [R] How to emulate perl style of reading files ?   Duncan Murdoch
• [R] How to emulate perl style of reading files ?   Prof Brian Ripley
• [R] how to estimate the parameters in a bivariate weibull distribution?   程燕
• [R] how to export ".xls" file with colorful cells?   XinMeng
• [R] how to export ".xls" file with colorful cells?   Marc Schwartz
• [R] how to export ".xls" file with colorful cells?   Gabor Grothendieck
• [R] how to export ".xls" file with colorful cells?   Kevin Wright
• [R] How to extract component number of RMSEP in RMSEP plot   Jason Lee
• [R] How to extract component number of RMSEP in RMSEP plot   Jason Lee
• [R] How to extract component number of RMSEP in RMSEP plot   Jason Lee
• [R] How to extract folowing data?   Megh Dal
• [R] How to extract folowing data?   Ben Tupper
• [R] How to filter a data frame?   rlearner309
• [R] How to filter a data frame?   John Kane
• [R] How to filter a data frame?   Marc Schwartz
• [R] How to filter a data frame?   milton ruser
• [R] How to filter a data frame?   Peter Dalgaard
• [R] How to filter a data frame?   John Kane
• [R] How to filter a data frame?   Roland Rau
• [R] How to filter a data frame?   rlearner309
• [R] how to get confidential interval for classification accuracy using 10-fold validation in svm package   larry88
• [R] how to get confidential interval for classification accuracy using 10-fold validation in svm package   larry88
• [R] How to get rule number in arules   Daniel Wagner
• [R] How to get rule number in arules   Hans W. Borchers
• [R] how to get the position of a vector-value   Jörg Groß
• [R] how to get the position of a vector-value   Katharine Mullen
• [R] how to get the position of a vector-value   jim holtman
• [R] How to load stats4 package   Surendra champanerkar
• [R] How to load stats4 package   Duncan Murdoch
• [R] How to output 0.405852702657738 as 0.405853 ?   Daren Tan
• [R] How to output 0.405852702657738 as 0.405853 ?   ctu at bigred.unl.edu
• [R] How to output R image to a file?   Aiste Aistike
• [R] How to output R image to a file?   Erik Iverson
• [R] How to output R image to a file?   Aiste Aistike
• [R] How to pass function argument of same name to internal call?   Carl Witthoft
• [R] How to pass function argument of same name to internal call?   Duncan Murdoch
• [R] How to preserve the numeric format and digits ?   Daren Tan
• [R] How to preserve the numeric format and digits ?   milton ruser
• [R] How to preserve the numeric format and digits ?   Austin, Matt
• [R] How to set directory Rscript runs in/Sweave output directory   Paul.Rustomji at csiro.au
• [R] How to set directory Rscript runs in/Sweave output directory   Prof Brian Ripley
• [R] How to set the parameters in Trellis Graphics (by Lattice package)   G.H. Zuo
• [R] How to set the parameters in Trellis Graphics (by Lattice package)   Felix Andrews
• [R] How to simulate heteroscedasticity (correlation)   Jörg Groß
• [R] How to simulate heteroscedasticity (correlation)   Patrizio Frederic
• [R] How to solve systems of nonlinear equations in R?   François Aucoin
• [R] How to solve systems of nonlinear equations in R?   Stuart Nettleton
• [R] How to solve systems of nonlinear equations in R?   Berend Hasselman
• [R] How to solve systems of nonlinear equations in R?   Ravi Varadhan
• [R] how to speed up this for loop?   Rheannon
• [R] how to speed up this for loop?   bartjoosen
• [R] how to speed up this for loop?   Rheannon
• [R] how to speed up this for loop?   Nordlund, Dan (DSHS/RDA)
• [R] how to speed up this for loop?   Nordlund, Dan (DSHS/RDA)
• [R] how to split the string   Kurapati, Ravichandra (Ravichandra)
• [R] how to test this multivariate normal distribution?   domenico pestalozzi
• [R] How to unsubscribe?   Endre Domiczi
• [R] How to unsubscribe?   Marc Schwartz
• [R] How to....   Jia Ying Mei
• [R] How to....   jim holtman
• [R] How to....   Jim Lemon
• [R] How to....   Jia Ying Mei
• [R] How to....   Jia Ying Mei
• [R] How to....   Jia Ying Mei
• [R] Howto Draw Bimodal Gamma Curve with User Supplied Parameters   Gundala Viswanath
• [R] Howto Draw Bimodal Gamma Curve with User Supplied Parameters   Patrizio Frederic
• [R] Howto Initialize Parameter of Gamma Mixture Densities for EM   Gundala Viswanath
• [R] Howto Restart A Function with Try-Error Catch   Gundala Viswanath
• [R] Howto Restart A Function with Try-Error Catch   Patrick Connolly
• [R] Howto view function's source code of an installed package   Gundala Viswanath
• [R] Howto view function's source code of an installed package   Paul Hiemstra
• [R] I can not see help.start() in Ubuntu.   xiaopeng hu
• [R] Identifying common prefixes from a vector of words, and delete those prefixes   John Kane
• [R] Identifying common prefixes from a vector of words, and delete those prefixes   Christos Hatzis
• [R] Identifying common prefixes from a vector of words, and delete those prefixes   Daren Tan
• [R] Identifying common prefixes from a vector of words, and delete those prefixes   Richard.Cotton at hsl.gov.uk
• [R] Identifying Points That Belongs to Components of Mixture Models   Gundala Viswanath
• [R] if one of 4 conditions is not satisfied   mysimbaa
• [R] if one of 4 conditions is not satisfied   Marc Schwartz
• [R] if one of 4 conditions is not satisfied   mysimbaa
• [R] if one of 4 conditions is not satisfied   Peng Jiang
• [R] Ignore blank columns when reading a row from a table   naw3 at duke.edu
• [R] Ignore blank columns when reading a row from a table   Erik Iverson
• [R] Ignore blank columns when reading a row from a table   Jorge Ivan Velez
• [R] Ignore blank columns when reading a row from a table   Bernardo Rangel Tura
• [R] Ignore previous emails   Williams, Robin
• [R] ignore warning messages?   Hua Li
• [R] ignore warning messages?   Henrique Dallazuanna
• [R] ignore warning messages?   Jorge Ivan Velez
• [R] ignore warning messages?   Hua Li
• [R] implementation of Prentice method in cch()   Jin Wang
• [R] in axis() suppressing axis line but keeping tick marks   Prof Brian Ripley
• [R] incrementing for loop by 2   Clark, Jennifer H
• [R] incrementing for loop by 2   Marc Schwartz
• [R] incrementing for loop by 2   Wacek Kusnierczyk
• [R] incrementing for loop by 2   Dimitris Rizopoulos
• [R] indicating significant differences in boxplots   Sebastian Merz
• [R] indicating significant differences in boxplots   Jim Lemon
• [R] indicating significant differences in boxplots   John Kane
• [R] Indicator Kriging?   Sascha Bellaire
• [R] Indicator Kriging?   ONKELINX, Thierry
• [R] initialize a factor vector   Johannes Huesing
• [R] initialize a factor vector   Gavin Simpson
• [R] initialize a factor vector   Johannes Huesing
• [R] initialize a factor vector   Johannes Huesing
• [R] initialize a factor vector   Patrick Burns
• [R] initialize a factor vector   Patrick Burns
• [R] initialize a matrix   mysimbaa
• [R] initialize a matrix   mysimbaa
• [R] initialize a matrix   mysimbaa
• [R] initialize a matrix   mysimbaa
• [R] initialize a matrix   mysimbaa
• [R] initialize a matrix   mysimbaa
• [R] initialize a matrix   mysimbaa
• [R] INSEED Statistics Workshop on Bayesian statistics using OpenBUGS and R   INSEED statistics workshop
• [R] INSEED statistics workshop on Statistical Models and Practices in Epidemiology (using R)   INSEED statistics workshop
• [R] Insert rows into a pre-existing data frame   naw3 at duke.edu
• [R] Insert rows into a pre-existing data frame   milton ruser
• [R] Insert text in data.frame   Mafalda Viana
• [R] Insert text in data.frame   jim holtman
• [R] instal tar.gz package on windows   georgiana onicescu
• [R] instal tar.gz package on windows   Marc Schwartz
• [R] instal tar.gz package on windows   Stefan Evert
• [R] Install Packages in Windows Vista   nicholasw22
• [R] Install Packages in Windows Vista   Charles Annis, P.E.
• [R] Install Packages in Windows Vista   Gabor Grothendieck
• [R] Installation 2.7.1 [requires Perl >= 5.8.0]   Prof Brian Ripley
• [R] Installation error for RCurl in Redhat enterrpise 5   Momin, Amin A
• [R] Installation error for RCurl in Redhat enterrpise 5   Prof Brian Ripley
• [R] Installation error for RCurl in Redhat enterrpise 5   Momin, Amin A
• [R] Installation of garchOxFit   Charlotte Falk Mogensen
• [R] Installation of packages via GUI, Mac OS X   David Afshartous
• [R] Installation of packages via GUI, Mac OS X   Don MacQueen
• [R] Installing R into home directory?   Steve Cadman
• [R] Installing R into home directory?   p_connolly at slingshot.co.nz
• [R] Installing R package but got Fortran 90 error   Daren Tan
• [R] Installing R packages in Textmate   Arthur Roberts
• [R] Installing R packages in Textmate   Don MacQueen
• [R] Installing RWinEdt   rkevinburton at charter.net
• [R] Installing RWinEdt   Uwe Ligges
• [R] Installing RWinEdt   rkevinburton at charter.net
• [R] Installing RWinEdt   Uwe Ligges
• [R] Insurance review statistical methods   Kenneth Roy Cabrera Torres
• [R] Insurance review statistical methods   Yasir Kaheil
• [R] Insurance review statistical methods   Yasir Kaheil
• [R] Insurance review statistical methods   Vincent Goulet
• [R] Integrating R and Textmate   Arthur Roberts
• [R] Integrating R and Textmate   Uwe Ligges
• [R] Integrating R and Textmate   Rob Goedman
• [R] Integrating R and Textmate   Hans-Jörg Bibiko
• [R] Interactive plot   Megh Dal
• [R] Interactive plot   Duncan Murdoch
• [R] Interactive plot   Megh Dal
• [R] Interactive plot   Duncan Murdoch
• [R] Interactive plot   David Scott
• [R] Interactive plot using playwith() and abline   Christoph Scherber
• [R] Interactive plot using playwith() and abline   Felix Andrews
• [R] Interest in a Use R Group in San Francisco area?   Jim Porzak
• [R] Interest in a Use R Group in San Francisco area?   Marc Schwartz
• [R] Interest in a Use R Group in San Francisco area?   Peter Dalgaard
• [R] Interest in a Use R Group in San Francisco area?   Marc Schwartz
• [R] Interest in a Use R Group in San Francisco area?   Peter Dalgaard
• [R] Interpolating a line and then summing there values for a diurnal oxygen curve (zoo object)   stephen sefick
• [R] Interpolating a line and then summing there values for a diurnal oxygen curve (zoo object)   Gabor Grothendieck
• [R] Interpolation of data   sprohl at na.uni-tuebingen.de
• [R] Interpolation of data   Daniel Malter
• [R] Interpolation of data   Daniel Malter
• [R] Interpolation of data   Daniel Malter
• [R] Interpolation of data   stephen sefick
• [R] Interpolation of data   Don MacQueen
• [R] Interpolation of data   Mike Lawrence
• [R] Interpretation of EXACT Statistical Test in finding the   (Ted Harding)
• [R] Interpretation of EXACT Statistical Test in finding the   DaveFrisch
• [R] Interpretation of EXACT Statistical Test in finding the probability as Std. Deviations (SumP)   DaveFrisch
• [R] Interpreting messages when building packages   Johannes Huesing
• [R] Interpreting messages when building packages   Duncan Murdoch
• [R] Interpreting messages when building packages   Johannes Huesing
• [R] Interpreting messages when building packages   Duncan Murdoch
• [R] Interpreting messages when building packages   Johannes Huesing
• [R] Interpreting messages when building packages   Duncan Murdoch
• [R] Interpreting messages when building packages   Johannes Huesing
• [R] Interpreting messages when building packages   Johannes Huesing
• [R] interpreting mixed model anova results   Brooke LaFlamme
• [R] interpreting mixed model anova results   hpdutra
• [R] Is conditional evaluation of R code chunks possible in Sweave ?   Paul.Rustomji at csiro.au
• [R] Is R's fast fourier transform function different from "fft2" in Matlab?   Li Li
• [R] Is there a better way to check if an element of a list exists than using match on names?   jim holtman
• [R] Is there a better way to check if an element of a list exists than using match on names?   Paul.Rustomji at csiro.au
• [R] Is there a way to avoid loading dependendent packages?   Paul.Rustomji at csiro.au
• [R] Is there a way to avoid loading dependendent packages?   Duncan Murdoch
• [R] Is there a way to avoid loading dependendent packages?   Henrik Bengtsson
• [R] Is there an equivalent * operator?   Williams, Robin
• [R] Is there an equivalent * operator?   Duncan Murdoch
• [R] Is there an equivalent * operator?   john seers (IFR)
• [R] Is there an equivalent * operator?   Felix Andrews
• [R] Is there an equivalent * operator?   René Capell
• [R] is there an equivalent of prop.table but for counts   markleeds at verizon.net
• [R] is there an equivalent of prop.table but for counts   Jorge Ivan Velez
• [R] is there an equivalent of prop.table but for counts   Jorge Ivan Velez
• [R] Is there anyway to clip the bottom of a barplot?   Arthur Roberts
• [R] Is there anyway to clip the bottom of a barplot?   hadley wickham
• [R] Is there way to multiple plots on gap.plot?   Arthur Roberts
• [R] Is there way to multiple plots on gap.plot?   Yasir Kaheil
• [R] Is there way to multiple plots on gap.plot?   Jim Lemon
• [R] Is there way to multiple plots on gap.plot?   Jim Lemon
• [R] Issue with postscript figures using WinAnsi encoding   Michael Rennie
• [R] Issue with postscript figures using WinAnsi encoding   Michael Rennie
• [R] Issue with postscript figures using WinAnsi encoding   Michael Rennie
• [R] issues with gap.plot function   Zheng Lu
• [R] issues with gap.plot function   Ben Bolker
• [R] Iterations   rkevinburton at charter.net
• [R] Iterations   Stephan Kolassa
• [R] Iterations   Jeff Newmiller
• [R] Iterations   Michael Rennie
• [R] Iterations   Michael Rennie
• [R] Iterations   Erik Iverson
• [R] Iterations   rkevinburton at charter.net
• [R] Iterations   rkevinburton at charter.net
• [R] Iterations   Erik Iverson
• [R] Iterations   Nordlund, Dan (DSHS/RDA)
• [R] Iterations   Rolf Turner
• [R] john chambers R book   markleeds at verizon.net
• [R] john chambers R book   Christos Hatzis
• [R] john chambers R book   Marc Schwartz
• [R] john chambers R book   stephen sefick
• [R] Just 2 more questions - for now!   Williams, Robin
• [R] Just 2 more questions - for now!   stephen sefick
• [R] Just 2 more questions - for now!   Mark Difford
• [R] Just 2 more questions - for now!   Duncan Murdoch
• [R] Just 2 more questions - for now!   john seers (IFR)
• [R] keeping seperate row.names   Patrick Richardson
• [R] keywords   Edna Bell
• [R] keywords   Charilaos Skiadas
• [R] kriging problem(?)   robert.ptacnik at niva.no
• [R] kriging problem(?)   Paul Hiemstra
• [R] L1 nonlinear approximation   Tine Mlac
• [R] L1 nonlinear approximation   roger koenker
• [R] L1 nonlinear approximation   Greg Snow
• [R] Labelling curves on graphs   (Ted Harding)
• [R] Labelling curves on graphs   Austin, Matt
• [R] Labelling curves on graphs   (Ted Harding)
• [R] Labelling curves on graphs   Barry Rowlingson
• [R] Labelling curves on graphs   Frank E Harrell Jr
• [R] Labelling curves on graphs   Barry Rowlingson
• [R] Labelling curves on graphs   Frank E Harrell Jr
• [R] Labelling curves on graphs   (Ted Harding)
• [R] Landscape mode for pdf   tolga.i.uzuner at jpmorgan.com
• [R] Landscape mode for pdf   Johannes Huesing
• [R] Landscape mode for pdf   jim holtman
• [R] Landscape mode for pdf   tolga.i.uzuner at jpmorgan.com
• [R] lapply   Rajasekaramya
• [R] lapply   jim holtman
• [R] Large number of dummy variables   Alan Spearot
• [R] Large number of dummy variables   Alan Spearot
• [R] Large number of dummy variables   Doran, Harold
• [R] Large number of dummy variables   Bert Gunter
• [R] Large number of dummy variables   Douglas Bates
• [R] Large number of dummy variables   Doran, Harold
• [R] Large number of dummy variables   Martin Maechler
• [R] latex styling for R regression outputs   Matthias Bannert
• [R] latex styling for R regression outputs   Paul Hiemstra
• [R] lattice question   markleeds at verizon.net
• [R] lattice question   Felix Andrews
• [R] lattice question   Troels Ring
• [R] lattice smooth   Troels Ring
• [R] lattice smooth problem?   Troels Ring
• [R] lattice smooth problem?   Gavin Simpson
• [R] Lattice Version of grconvertX or variant on panel.text?   Bryan Hanson
• [R] Lattice Version of grconvertX or variant on panel.text?   hadley wickham
• [R] Lattice Version of grconvertX or variant on panel.text?   Bryan Hanson
• [R] Lattice Version of grconvertX or variant on panel.text?   Gabor Grothendieck
• [R] Lattice wireframe: How to avoid drawing lines around polygons when using shade=TRUE   Deepayan Sarkar
• [R] Lattice wireframe: How to avoid drawing lines around polygons when using shade=TRUE   Oliver M. Haynold
• [R] Lattice wireframe: How to avoid drawing lines around polygons when using shade=TRUE   Oliver M. Haynold
• [R] lattice with bwplot   Roberts, Kyle
• [R] lattice with bwplot   Henrique Dallazuanna
• [R] Lattice: How to draw curves from given formulae   John Smith
• [R] Lattice: How to draw curves from given formulae   Deepayan Sarkar
• [R] Lattice: How to draw curves from given formulae   John Smith
• [R] Lattice: How to draw curves from given formulae   Deepayan Sarkar
• [R] Lattice: merged strips?   Mike Lawrence
• [R] Lattice: merged strips?   Mike Lawrence
• [R] Lattice: merged strips?   Duncan Mackay
• [R] Lattice: merged strips?   Mike Lawrence
• [R] Lattice: merged strips?   Deepayan Sarkar
• [R] Lattice: merged strips?   Mike Lawrence
• [R] Lattice: reasons for not passing subscripted "col", "pch", "lty", "fill" to panel functions   Deepayan Sarkar
• [R] Lattice: reasons for not passing subscripted "col", "pch", "lty", "fill" to panel functions   Vitalie Spinu
• [R] Layers in graphs   Thomas Fröjd
• [R] Layers in graphs   René Capell
• [R] Layers in graphs   Thomas Fröjd
• [R] layout is to xyplot as ??? is to qplot   Jim Price
• [R] layout is to xyplot as ??? is to qplot   hadley wickham
• [R] Legality Question about R's Open Source GNU GPL License   zerfetzen
• [R] Legality Question about R's Open Source GNU GPL License   Jim Porzak
• [R] Legality Question about R's Open Source GNU GPL License   Patrick Burns
• [R] Legality Question about R's Open Source GNU GPL License   Duncan Murdoch
• [R] Legality Question about R's Open Source GNU GPL License   Roland Rau
• [R] Legality Question about R's Open Source GNU GPL License   Marc Schwartz
• [R] Legality Question about R's Open Source GNU GPL License   zerfetzen
• [R] Legality Question about R's Open Source GNU GPL License   David Henderson
• [R] Legality Question about R's Open Source GNU GPL License   Gad Abraham
• [R] Legality Question about R's Open Source GNU GPL License   Gad Abraham
• [R] Legality Question about R's Open Source GNU GPL License   David Henderson
• [R] Legality Question about R's Open Source GNU GPL License   Charles Annis, P.E.
• [R] Likelihood ratio test between glm and glmer fits   COREY SPARKS
• [R] Likelihood ratio test between glm and glmer fits   Dimitris Rizopoulos
• [R] Likelihood ratio test between glm and glmer fits   Rune Haubo
• [R] Likelihood ratio test between glm and glmer fits   Douglas Bates
• [R] Likelihood ratio test between glm and glmer fits   Göran Broström
• [R] linear and non linear regression in 3D !   Param Priya Singh
• [R] lines() warning message   Ranney, Steven
• [R] lines() warning message   Peter Dalgaard
• [R] lines() warning message   Ranney, Steven
• [R] lines() warning message   Peter Dalgaard
• [R] Link functions in SEM   Jeroen Ooms
• [R] Link functions in SEM   Stas Kolenikov
• [R] Link functions in SEM   John Fox
• [R] list   Paul Adams
• [R] list   jim holtman
• [R] list genes w/n a genomic fragment   runner
• [R] list genes w/n a genomic fragment   Bert Gunter
• [R] list genes w/n a genomic fragment   Martin Morgan
• [R] List help   Rajasekaramya
• [R] List help   Henrique Dallazuanna
• [R] List help   Jorge Ivan Velez
• [R] List help   Rajasekaramya
• [R] List names help   Rajasekaramya
• [R] List names help   Sarah Goslee
• [R] lm and NA   Kenn Konstabel
• [R] lm() question   Ranney, Steven
• [R] lm() question   Christoph Scherber
• [R] lmer model with continuos non normal response variable, transformation needed?   Christoph Scherber
• [R] Location of HTML help files   Jan Smit
• [R] Location of HTML help files   Henrik Bengtsson
• [R] Location of HTML help files   Jan Smit
• [R] Location of HTML help files   Keith Ponting
• [R] log plots woes   Patrick Jackson
• [R] logistic regreesion and score test   刘杰
• [R] logistic regreesion and score test   Frank E Harrell Jr
• [R] Loglikelihood for x factorial?   ctu at bigred.unl.edu
• [R] Loglikelihood for x factorial?   Ben Bolker
• [R] long data frame selection error   Rheannon
• [R] long data frame selection error   jim holtman
• [R] long data frame selection error   John Kane
• [R] looking for alternative of 'if-else'   Arun Kumar Saha
• [R] looking for alternative of 'if-else'   Duncan Murdoch
• [R] looking for alternative of 'if-else'   ctu at bigred.unl.edu
• [R] looking for alternative of 'if-else'   Arun Kumar Saha
• [R] looking for alternative of 'if-else'   Duncan Murdoch
• [R] looking for alternative of 'if-else'   ctu at bigred.unl.edu
• [R] loop calculation   Ben Bolker
• [R] loop does not work   aude Valade
• [R] loop does not work   Sarah Goslee
• [R] loop for multiple regressions   Denise Xifara
• [R] Loop problem   fernanda lopez
• [R] Loop problem   Dimitris Rizopoulos
• [R] Loop problem   Daniel Malter
• [R] Loop problem   Gabor Grothendieck
• [R] Lots of huge matrices, for-loops, speed   Zarza
• [R] Lots of huge matrices, for-loops, speed   jim holtman
• [R] Lots of huge matrices, for-loops, speed   Ray Brownrigg
• [R] Lots of huge matrices, for-loops, speed   Moshe Olshansky
• [R] Lots of huge matrices, for-loops, speed   Rolf Turner
• [R] Lots of huge matrices, for-loops, speed   Moshe Olshansky
• [R] ls() and memory question   Edna Bell
• [R] ls() and memory question   jim holtman
• [R] mac install no font found problem in quartz display   Zhesi He
• [R] macros in R   Erin Hodgess
• [R] macros in R   Chuck Cleland
• [R] Major Cloud Computing Testbed Announced at University of Illinois   Ajay ohri
• [R] making zoo objects with zoo without format argument?   stephen sefick
• [R] making zoo objects with zoo without format argument?   Gabor Grothendieck
• [R] making zoo objects with zoo without format argument?   Gabor Grothendieck
• [R] making zoo objects with zoo without format argument?   stephen sefick
• [R] making zoo objects with zoo without format argument?   stephen sefick
• [R] making zoo objects with zoo without format argument?   Gabor Grothendieck
• [R] making zoo objects with zoo without format argument?   stephen sefick
• [R] making zoo objects with zoo without format argument?   Gabor Grothendieck
• [R] making zoo objects with zoo without format argument?   stephen sefick
• [R] making zoo objects with zoo without format argument?   stephen sefick
• [R] making zoo objects with zoo without format argument?   Gabor Grothendieck
• [R] manipulate a matrix2   Jon Hak
• [R] manipulate a matrix2   jim holtman
• [R] manipulate a matrix2   Jon Hak
• [R] manipulate a matrix2   jim holtman
• [R] manipulate a matrix2   Jon Hak
• [R] manipulate a matrix2   jim holtman
• [R] manipulate a matrix2   Jon Hak
• [R] Manipulate Data (with regular expressions)   Kunzler, Andreas
• [R] Manipulate Data (with regular expressions)   oscar Linares
• [R] Manipulate Data (with regular expressions)   Gabor Grothendieck
• [R] Manipulate Data (with regular expressions)   Kunzler, Andreas
• [R] Manipulate Data (with regular expressions)   Kenn Konstabel
• [R] Manipulate Data (with regular expressions)   Gabor Grothendieck
• [R] manipulating (extracting) data from distance matrices   Michael Rennie
• [R] manipulating (extracting) data from distance matrices   stephen sefick
• [R] manipulating (extracting) data from distance matrices   Michael Rennie
• [R] manipulating (extracting) data from distance matrices   Jon Olav Skoien
• [R] manipulating (extracting) data from distance matrices   Sarah Goslee
• [R] manipulating (extracting) data from distance matrices   Michael Rennie
• [R] Mapping data onto 1-10 score   rcoder
• [R] Mapping data onto 1-10 score   Jim Lemon
• [R] Mapping data onto score   rcoder
• [R] Mapping data onto score   Ben Tupper
• [R] Mapping data onto score   rcoder
• [R] Mapping data onto score   Ben Tupper
• [R] Mapping data onto score   rcoder
• [R] Mapping data onto score   rcoder
• [R] Mapping data onto score   rcoder
• [R] Mapping data onto score   jim holtman
• [R] Mapping data onto score   Bert Gunter
• [R] Marking Interval Length   Jia Ying Mei
• [R] Marking Interval Length   jim holtman
• [R] Marking Interval Length   Jia Ying Mei
• [R] Marking Interval Length   jim holtman
• [R] Matching Up Values   Steve Murray
• [R] Matching Up Values   Peter Alspach
• [R] Matching Up Values   Rolf Turner
• [R] Matching Up Values   hadley wickham
• [R] Matching Up Values   Steve Murray
• [R] Matching Up Values   Steve Murray
• [R] matplot help   Boyce, Morgan
• [R] matplot help   Michael Rennie
• [R] matplot help   Gabor Grothendieck
• [R] matplot help   Boyce, Morgan
• [R] Matrix barplot   Andreas Tille
• [R] Matrix barplot   Nutter, Benjamin
• [R] Matrix barplot   Jim Lemon
• [R] Matrix barplot   Andreas Tille
• [R] Matrix barplot   ajay ohri
• [R] Matrix barplot   Andreas Tille
• [R] Matrix barplot   Andreas Tille
• [R] Matrix from List   Nelson Villoria
• [R] Matrix from List   jim holtman
• [R] matrix multiplication question   Murali K
• [R] matrix multiplication question   Duncan Murdoch
• [R] matrix multiplication question   Tsjerk Wassenaar
• [R] matrix multiplication question   Doran, Harold
• [R] Matrix set value problem   Valentino Botta
• [R] Matrix set value problem   ONKELINX, Thierry
• [R] Matrix set value problem   ctu at bigred.unl.edu
• [R] max   Paul Adams
• [R] Maximization under constraits   Daniela Garavaglia
• [R] Maximization under constraits   Ben Bolker
• [R] Maximization under constraits   Ritwik Sinha
• [R] maximum likelihood method to fit a model   Prof Brian Ripley
• [R] maximum likelihood method to fit a model   silvia narduzzi
• [R] maximum likelihood method to fit a model   Patrizio Frederic
• [R] maximum likelihood method to fit a model   Peter Dalgaard
• [R] Mclust - which cluster is each observation in?   cnagy
• [R] Mclust - which cluster is each observation in?   Julian Burgos
• [R] Mclust ???   Peng Jiang
• [R] Meaning of Positive LogLikelihood   Gundala Viswanath
• [R] Meaning of Positive LogLikelihood   Erik Iverson
• [R] meaning of tests presented in anova(ols(...)) {Design package}   Frank E Harrell Jr
• [R] meaning of tests presented in anova(ols(...)) {Design package}   Dylan Beaudette
• [R] meaning of tests presented in anova(ols(...)) {Design package}   Mark Difford
• [R] Melt (reshape) question   Steve Murray
• [R] Melt (reshape) question   jim holtman
• [R] Melt (reshape) question   hadley wickham
• [R] Melt (reshape) question   Steve Murray
• [R] melting a list: basic question   baptiste auguie
• [R] melting a list: basic question   Dieter Menne
• [R] melting a list: basic question   baptiste auguie
• [R] melting a list: basic question   hadley wickham
• [R] melting a list: basic question   hadley wickham
• [R] melting a list: basic question   baptiste auguie
• [R] melting a list: basic question   hadley wickham
• [R] Messge ``no visible binding''.   Rolf Turner
• [R] Messge ``no visible binding''.   Gregory Warnes
• [R] Method for checking automatically which distribtions fits a data   ctu at bigred.unl.edu
• [R] Method for checking automatically which distribtions fits a data   David Reinke
• [R] Method for checking automatically which distribtions fits a data   Stephen Tucker
• [R] Method for checking automatically which distribtions fits a data   Ben Bolker
• [R] Method for checking automatically which distribtions fits a data   hadley wickham
• [R] Method for checking automatically which distribtions fits a data   Frank E Harrell Jr
• [R] Method for checking automatically which distribtions fits a data   Gundala Viswanath
• [R] Migrating from S-Plus to R - Exporting Tables   Leandro Marino
• [R] Migrating from S-Plus to R - Exporting Tables   jim holtman
• [R] Migrating from S-Plus to R - Exporting Tables   Gustaf Rydevik
• [R] Minor Bug in Documentation of merge()   Roland Rau
• [R] Minor Bug in Documentation of merge()   Duncan Murdoch
• [R] Mixed effects model where nested factor is not the repeated across treatments lme???   ctu at bigred.unl.edu
• [R] Mixed effects model where nested factor is not the repeated across treatments lme???   Mark Difford
• [R] Mixed effects model where nested factor is not the repeated across treatments lme???   M Ensbey
• [R] Mixed model question.   Rolf Turner
• [R] Mixed model question.   Douglas Bates
• [R] Mixed model question.   Rolf Turner
• [R] mle2(): logarithm of negative pdfs   Zornitsa Luleva
• [R] mle2(): logarithm of negative pdfs   Patrizio Frederic
• [R] model mix problem. FALSE CONVERGENCE   mergullo
• [R] model.tables standard errors   iwhite at staffmail.ed.ac.uk
• [R] modeling binary response variables   Kevin J Emerson
• [R] modeling binary response variables   Daniel Malter
• [R] modeling binary response variables   Simon Blomberg
• [R] modeling binary response variables   Daniel Malter
• [R] modeling binary response variables   Simon Blomberg
• [R] modeling binary response variables   Daniel Malter
• [R] modified ks.test?   Shuhua Zhan
• [R] Moran's I test- Ordinal Logistic Regression Model   Rees, Lisa Marie (MU-Student)
• [R] Moran's I- Ordinal Logistic Regression   Lisa Rees
• [R] More compact form of lm object that can be used for prediction?   Marc Schwartz
• [R] More compact form of lm object that can be used for prediction?   Woolner, Keith
• [R] More compact form of lm object that can be used for prediction?   Marc Schwartz
• [R] More compact form of lm object that can be used for prediction?   Charles C. Berry
• [R] More compact form of lm object that can be used for prediction?   Woolner, Keith
• [R] More compact form of lm object that can be used for prediction?   Woolner, Keith
• [R] more environment questions   Edna Bell
• [R] more environment questions   Gabor Grothendieck
• [R] more environment questions   Edna Bell
• [R] more environment questions   Gabor Grothendieck
• [R] Most often pairs of chars across grouping variable   svga at arcor.de
• [R] Most often pairs of chars across grouping variable   Marc Schwartz
• [R] Most often pairs of chars across grouping variable   svga at arcor.de
• [R] mpirun question with Rmpi   Erin Hodgess
• [R] mpirun question with Rmpi   Martin Morgan
• [R] Multinomial logistic regression with non-numerical data.   TL Vincent
• [R] Multiple Plots and y Axis Labels   jonboym
• [R] multiple separators in scan() functions   milton ruser
• [R] multiple separators in scan() functions   Prof Brian Ripley
• [R] Multiple time series plots   Kerpel, John
• [R] Multiple time series plots   stephen sefick
• [R] Multiple time series plots   Kerpel, John
• [R] Multiple time series plots   Gabor Grothendieck
• [R] multiplication question   Murali Menon
• [R] multiplication question   Peter Alspach
• [R] multiplication question   N. Lapidus
• [R] multiplication question   Henrique Dallazuanna
• [R] multiplication question   Henrique Dallazuanna
• [R] multiplication question   Kenn Konstabel
• [R] multiplication question   Murali Menon
• [R] multiplication question   Moshe Olshansky
• [R] multiv   Somesan, Ileana
• [R] multiv   Mark Difford
• [R] name returned by lapply   Antje
• [R] name returned by lapply   Gavin Simpson
• [R] name returned by lapply   Antje
• [R] name returned by lapply   Gavin Simpson
• [R] name returned by lapply   Antje
• [R] name returned by lapply   Antje
• [R] name returned by lapply   Tony Plate
• [R] NAMESPACE vs internal.Rd   cgenolin at u-paris10.fr
• [R] NAMESPACE vs internal.Rd   Berwin A Turlach
• [R] NAMESPACE vs internal.Rd   cgenolin at u-paris10.fr
• [R] NAMESPACE vs internal.Rd   Berwin A Turlach
• [R] NAMESPACE vs internal.Rd   cgenolin at u-paris10.fr
• [R] NAMESPACE vs internal.Rd   Berwin A Turlach
• [R] NAs - NAs are not allowed in subscripted assignments   Kunzler, Andreas
• [R] NAs - NAs are not allowed in subscripted assignments   Richard.Cotton at hsl.gov.uk
• [R] NAs - NAs are not allowed in subscripted assignments   Kunzler, Andreas
• [R] NAs - NAs are not allowed in subscripted assignments   Gabor Csardi
• [R] NAs - NAs are not allowed in subscripted assignments   Nordlund, Dan (DSHS/RDA)
• [R] NAs - NAs are not allowed in subscripted assignments   Nordlund, Dan (DSHS/RDA)
• [R] NAs - NAs are not allowed in subscripted assignments   Gabor Csardi
• [R] NAs - NAs are not allowed in subscripted assignments   Nordlund, Dan (DSHS/RDA)
• [R] NAs - NAs are not allowed in subscripted assignments   Gabor Csardi
• [R] NAs - NAs are not allowed in subscripted assignments   Carl Witthoft
• [R] Need help   renata.camargo05 at ntlworld.com
• [R] Need help   Richard.Cotton at hsl.gov.uk
• [R] Need help   Prof Brian Ripley
• [R] Need help   Prof Brian Ripley
• [R] need help in parametric bootstrap   laila khalfan
• [R] Need ideas on how to show spikes in my data and how to code it in R   S Ellison
• [R] Need ideas on how to show spikes in my data and how to code it in R   Thomas Fröjd
• [R] Need ideas on how to show spikes in my data and how to code it in R   Thomas Fröjd
• [R] need some help   Kurapati, Ravichandra (Ravichandra)
• [R] need some help   jim holtman
• [R] Negative Binomial Regression   jcarmichael
• [R] Negative Binomial Regression   Ben Bolker
• [R] Negative Binomial Regression   Prof Brian Ripley
• [R] Negative Binomial Regression   Ben Bolker
• [R] Negative Binomial Regression   Prof Brian Ripley
• [R] Negative Binomial Regression   Ben Bolker
• [R] negative P-values with shapiro.test   Mark Cowley
• [R] negative P-values with shapiro.test   Martin Maechler
• [R] negative P-values with shapiro.test   Martin Maechler
• [R] nested calls, variable scope   Jacob Wegelin
• [R] nested calls, variable scope   Jacob Wegelin
• [R] netCDF to TIFF   Daniel Steinberg
• [R] netCDF to TIFF   Yasir Kaheil
• [R] network   Dry, Jonathan R
• [R] network   Gabor Csardi
• [R] network   Gabor Csardi
• [R] network   Dry, Jonathan R
• [R] network   Gabor Csardi
• [R] neural networks   Donna Tucker
• [R] New Zealand Maps   Tom Love
• [R] New Zealand Maps   Ray Brownrigg
• [R] New Zealand Maps   Ray Brownrigg
• [R] Newbie's question about lm   Ptit_Bleu
• [R] Newbie's question about lm   Mark Difford
• [R] NLME questions -- interpretation of results   Jenny Sun
• [R] NLME questions -- interpretation of results   ctu at bigred.unl.edu
• [R] NLME questions -- interpretation of results   Jenny Sun
• [R] NLME questions -- interpretation of results   ctu at bigred.unl.edu
• [R] nlme, lme( ) convergence and selection of effects   Thiago Cortez Costa
• [R] nlminb--lower bound for parameters are dependent on each others   Kyeongmi Cheon
• [R] nls and "plinear" algorithm   Allan Clark
• [R] nls and "plinear" algorithm   Duncan Murdoch
• [R] nls and "plinear" algorithm   Peter Dalgaard
• [R] nls and "plinear" algorithm   Katharine Mullen
• [R] nls weights warning message   Lisa Readdy
• [R] nls weights warning message   Prof Brian Ripley
• [R] nls weights warning message   Prof Brian Ripley
• [R] Non-linearly constrained optimisation   tolga.i.uzuner at jpmorgan.com
• [R] Non-linearly constrained optimisation   Stuart Nettleton
• [R] Non-linearly constrained optimisation   Gabor Grothendieck
• [R] Non-linearly constrained optimisation   Hans W. Borchers
• [R] Non-normal data issues in PhD software engineering experiment   Gustaf Rydevik
• [R] Non-normal data issues in PhD software engineering experiment   hadley wickham
• [R] Non-normal data issues in PhD software engineering experiment   andrewjacksonTCD
• [R] Non-normal data issues in PhD software engineering experiment   Andrew Jackson
• [R] Non-normal data issues in PhD software engineering experiment   Daniel Malter
• [R] normalised/transformed regressions   tolga.i.uzuner at jpmorgan.com
• [R] normalised/transformed regressions   Greg Snow
• [R] normalised/transformed regressions   tolga.i.uzuner at jpmorgan.com
• [R] normalised/transformed regressions   Greg Snow
• [R] normalised/transformed regressions   tolga.i.uzuner at jpmorgan.com
• [R] number of effective tests   Georg Ehret
• [R] number of effective tests   Moshe Olshansky
• [R] number of effective tests   Daniel Malter
• [R] number of effective tests   Charles C. Berry
• [R] Numbers as Points in Graphs   hippie dream
• [R] Numbers as Points in Graphs   milton ruser
• [R] Numbers as Points in Graphs   hippie dream
• [R] Numbers as Points in Graphs   markleeds at verizon.net
• [R] Numbers as Points in Graphs   milton ruser
• [R] Numbers as Points in Graphs   (Ted Harding)
• [R] Numbers as Points in Graphs   hippie dream
• [R] Numbers as Points in Graphs   markleeds at verizon.net
• [R] Numerical question   Zhang Yanwei - Princeton-MRAm
• [R] Numerical question   stephen sefick
• [R] Numerical question   (Ted Harding)
• [R] Numerical question   Duncan Murdoch
• [R] Object-oriented programming in R for Java programmers?   Werner Wernersen
• [R] Object-oriented programming in R for Java programmers?   Johannes Huesing
• [R] Object-oriented programming in R for Java programmers?   Jeroen Ooms
• [R] Object-oriented programming in R for Java programmers?   Stephen Tucker
• [R] Object-oriented programming in R for Java programmers?   Stephen Tucker
• [R] Odd behavior of remove command   Dennis Fisher
• [R] odd dnorm behaviour (?)   Mike Lawrence
• [R] odd dnorm behaviour (?)   Mike Lawrence
• [R] odd dnorm behaviour (?)   Moshe Olshansky
• [R] odd dnorm behaviour (?)   Charles C. Berry
• [R] odds ratios in multiway tables (stratified)   Wim Bertels
• [R] odds ratios in multiway tables (stratified)   Marc Schwartz
• [R] odds ratios in multiway tables (stratified)   Wim Bertels
• [R] odds ratios in multiway tables (stratified)   Marc Schwartz
• [R] odfWeave problem in 7.1?   Jim Porzak
• [R] odfWeave problem in 7.1?   Jim Porzak
• [R] odfWeave problem in 7.1?   Dieter Menne
• [R] odfWeave problem in 7.1?   Jim Porzak
• [R] odfWeave problem in 7.1?   Prof Brian Ripley
• [R] Odp: how to speed up this for loop?   Petr PIKAL
• [R] Odp: sum each row and output results   Petr PIKAL
• [R] Odp: aggregate months to years   Petr PIKAL
• [R] Odp: calculate differences - strange outcome   Petr PIKAL
• [R] Odp: Colours in R   Petr PIKAL
• [R] Odp: Graph   Petr PIKAL
• [R] Odp: newbie needs help plotting time series   Petr PIKAL
• [R] Odp: Re ad in a file - produce independent vectors   Petr PIKAL
• [R] Odp: specifying data   Petr PIKAL
• [R] Odp: FW: RES: bug in axis.Date? was (Re: newbie needs help plottingtimeseries)   Petr PIKAL
• [R] Odp: FW: RES: bug in axis.Date? was (Re: newbie needs help plottingtimeseries)   Kathi
• [R] Odp: RES: bug in axis.Date? was (Re: newbie needs help plotting timeseries)   Petr PIKAL
• [R] Odp: set values in data.frame to NA conditional on another data.frame   Petr PIKAL
• [R] Off topic: SS formulae for 3-way repeated measure anova (for when aov() fails)   Mike Lawrence
• [R] Off topic: Tcl/Tk outside R.   Rolf Turner
• [R] Off topic: Tcl/Tk outside R.   Peter Dalgaard
• [R] Off topic: Tcl/Tk outside R.   R P Herrold
• [R] Off topic: Tcl/Tk outside R.   Rolf Turner
• [R] Off topic: Tcl/Tk outside R.   Rolf Turner
• [R] Off topic: Tcl/Tk outside R.   Jim Lemon
• [R] Off-topic - Data needed   Bogaso Cristofer
• [R] On creating grouped data set.   Dong-hyun Oh
• [R] On creating grouped data set.   jim holtman
• [R] one-site competition data // curve fitting   Thiemo Schreiber
• [R] one-site competition data // curve fitting   Joerg van den Hoff
• [R] one-site competition data // curve fitting   Gabor Grothendieck
• [R] one-site competition data // curve fitting   Ben Bolker
• [R] only "T" becomes logical colum with read.table   Luis F
• [R] only "T" becomes logical colum with read.table   Henrique Dallazuanna
• [R] Opening files from R terminal - appologies   Williams, Robin
• [R] Opening files from R terminal - appologies   Gabor Grothendieck
• [R] Opening files from R terminal - appologies   Rossouw, Ruan (RF)
• [R] Opening files from R terminal - appologies   Sarah Goslee
• [R] Opening files from R terminal - appologies   Prof Brian Ripley
• [R] Operator overloading   Tine
• [R] Operator overloading   Peter Dalgaard
• [R] Operator overloading   hadley wickham
• [R] Operator overloading   Peter Dalgaard
• [R] Operator overloading   Spencer Graves
• [R] optim fails when using arima   MAIDER MATEOS DEL PINO
• [R] Optimal lag selection in Granger Causality tests   tolga.i.uzuner at jpmorgan.com
• [R] Optimal lag selection in Granger Causality tests   ONKELINX, Thierry
• [R] Optimal lag selection in Granger Causality tests   tolga.i.uzuner at jpmorgan.com
• [R] Optimal lag selection in Granger Causality tests   Matthieu Stigler
• [R] Optimal lag selection in Granger Causality tests   tolga.i.uzuner at jpmorgan.com
• [R] optimize function help!!   emir.toktar at computer.org
• [R] optimize simultaneously two binomials inequalities using nlm   emir.toktar at gmail.com
• [R] options() question for displaying numbers in the GUI   tolga.i.uzuner at jpmorgan.com
• [R] options() question for displaying numbers in the GUI   Henrique Dallazuanna
• [R] options() question for displaying numbers in the GUI   tolga.i.uzuner at jpmorgan.com
• [R] Order of columns(variables) in dataframe   Daniel Wagner
• [R] Order of columns(variables) in dataframe   jim holtman
• [R] Order of columns(variables) in dataframe   Dimitris Rizopoulos
• [R] Order of columns(variables) in dataframe   (Ted Harding)
• [R] Orthogonal polynomials and poly   giovanni parrinello
• [R] Orthogonal polynomials and poly   Prof Brian Ripley
• [R] OT: course in research administration   Christopher W. Ryan
• [R] OT: Data mining on demand .Using cloud computers.   Ajay ohri
• [R] OT:Selling Data Mining Cloud-A Concept   Ajay ohri
• [R] Otpmial initial centroid in kmeans   Chua Siang Li
• [R] Otpmial initial centroid in kmeans   Gavin Simpson
• [R] outlining symbol in legend with blackline   stephen sefick
• [R] outlining symbol in legend with blackline   Yasir Kaheil
• [R] Output design question   Michael Kubovy
• [R] Output design question   Henrique Dallazuanna
• [R] Output Nicely formatted tables from R   Bill Cunliffe
• [R] Output Nicely formatted tables from R   Abhijit Dasgupta
• [R] Overlay of simple plots   Phillip R. Hunt
• [R] Overlay of simple plots   stephen sefick
• [R] p-value for Nonmetric Multidimentional Scaling?   Michael Denslow
• [R] p-value for Nonmetric Multidimentional Scaling?   Bill.Venables at csiro.au
• [R] p-value for Nonmetric Multidimentional Scaling?   Gavin Simpson
• [R] Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd   David Hajage
• [R] Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd   David Hajage
• [R] Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd   David Hajage
• [R] Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd   Frank E Harrell Jr
• [R] Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd   Frank E Harrell Jr
• [R] package segmented problem   Alan Kelly
• [R] package segmented problem   milton ruser
• [R] Pairs() function: selective changing of ylim; use of key   David Afshartous
• [R] Panel of pie charts   Amin Momin
• [R] Panel of pie charts   John Kane
• [R] Panel of pie charts   Richard.Cotton at hsl.gov.uk
• [R] Panel of pie charts   Gavin Simpson
• [R] par("din") vs dev.size()   Sarah Goslee
• [R] par("din") vs dev.size()   Prof Brian Ripley
• [R] par() function does not work   Fabio Sanchez
• [R] par() function does not work   Duncan Murdoch
• [R] par() function does not work   john seers (IFR)
• [R] par() function does not work   Peter Dalgaard
• [R] par() function does not work   Prof Brian Ripley
• [R] par() function does not work   john seers (IFR)
• [R] par() function does not work   Henrique Dallazuanna
• [R] par() function does not work   Fabio Sanchez
• [R] Parallel Processing and Linear Regression   Alan Spearot
• [R] Parallel Processing and Linear Regression   Martin Morgan
• [R] Parallel R   Juan Pablo Romero Méndez
• [R] Parallel R   Martin Morgan
• [R] Parallel R   Luke Tierney
• [R] Parameter names in nls   rhelp.20.trevva at spamgourmet.com
• [R] Parameter names in nls   Rolf Turner
• [R] Parameter names in nls   rhelp.20.trevva at spamgourmet.com
• [R] Parameter names in nls   Ben Bolker
• [R] parametric bootstrap   laila khalfan
• [R] parametric bootstrap   laila khalfan
• [R] parametric bootstrap   Prof Brian Ripley
• [R] parametric bootstrap   laila khalfan
• [R] parametric bootstrap   laila khalfan
• [R] Parametric survival models with left truncated, right censored data   Göran Broström
• [R] Parsing   Paolo Sonego
• [R] Parsing   jim holtman
• [R] Parsing   Paolo Sonego
• [R] Parsing   jim holtman
• [R] Parsing   Paolo Sonego
• [R] Parsing   jim holtman
• [R] Parsing   Paolo Sonego
• [R] passing a variable at the command line   Erin Hodgess
• [R] passing a variable at the command line   Sebastian P. Luque
• [R] passing a variable at the command line   Marc Schwartz
• [R] passing a variable at the command line   Dirk Eddelbuettel
• [R] passing a variable at the command line   Luke Tierney
• [R] passing arguments to a R script   Daren Tan
• [R] path and R CMD check   Christophe Genolini
• [R] path and R CMD check   Uwe Ligges
• [R] path and R CMD check   Christophe Genolini
• [R] pca   Alphonse Monkamg
• [R] pca   Zhang Yanwei - Princeton-MRAm
• [R] PCA : Error in eigen(cv,   Tanya Yatsunenko
• [R] PCA : Error in eigen(cv,   Daniel Malter
• [R] PCA : Error in eigen(cv,   Tanya Yatsunenko
• [R] PCA : Error in eigen(cv,   Daniel Malter
• [R] PCA on image data   Bio7
• [R] PCA on image data   Jorge Ivan Velez
• [R] PCA on image data   Bio7
• [R] PCA on image data   Jorge Ivan Velez
• [R] PCA on image data   Bio7
• [R] PCA on image data   Monica Pisica
• [R] Percent Change After Each Interval   Jia Ying Mei
• [R] Percentile Estimation From Kernel Density Estimate   Jeffrey_Bromaghin at fws.gov
• [R] Percentile Estimation From Kernel Density Estimate   Karl Ove Hufthammer
• [R] placing a text in the corner of a plot   Jörg Groß
• [R] placing a text in the corner of a plot   Jorge Ivan Velez
• [R] placing a text in the corner of a plot   Jörg Groß
• [R] placing a text in the corner of a plot   Rolf Turner
• [R] placing a text in the corner of a plot   Ben Tupper
• [R] placing a text in the corner of a plot   Jim Lemon
• [R] playwith package crashes on Mac   Michael Kubovy
• [R] playwith package crashes on Mac   Felix Andrews
• [R] playwith package crashes on Mac   Michael Lawrence
• [R] playwith package does not work on Ubuntu?   Felix Andrews
• [R] Plink bed files   Federico Calboli
• [R] Plink bed files   Robert Gentleman
• [R] Plot   Paul Adams
• [R] Plot   stephen sefick
• [R] Plot depends on conditions   mysimbaa
• [R] Plot depends on conditions   jim holtman
• [R] Plot depends on conditions   mysimbaa
• [R] plot gam "main effect functions" in one graph   Pancrazio Bertaccini
• [R] plot gam "main effect functions" in one graph   Daniel Malter
• [R] Plot Mixtures of Synthetically Generated Gamma Distributions   Gundala Viswanath
• [R] Plot Mixtures of Synthetically Generated Gamma Distributions   Jorge Ivan Velez
• [R] Plot Mixtures of Synthetically Generated Gamma Distributions   Jorge Ivan Velez
• [R] Plot Mixtures of Synthetically Generated Gamma Distributions   Moshe Olshansky
• [R] Plot Mixtures of Synthetically Generated Gamma Distributions   Stephen Tucker
• [R] Plot multiple datasets on a VCD ternary graph   theBenjamin
• [R] Plot multiple datasets on a VCD ternary graph   Jim Lemon
• [R] plot window   Henrique Dallazuanna
• [R] plot window   Leandro Marino
• [R] plot window   Gabor Grothendieck
• [R] plot zoo custom panel help   stephen sefick
• [R] plot zoo custom panel help   Gabor Grothendieck
• [R] plot zoo custom panel help   stephen sefick
• [R] plot zoo custom panel help   Gabor Grothendieck
• [R] plot zoo custom panel help   stephen sefick
• [R] plot zoo custom panel help   Gabor Grothendieck
• [R] plot(linear model) without lines   cryan at binghamton.edu
• [R] plot(linear model) without lines   Uwe Ligges
• [R] plot.zoo labels   ryan.sheftel at malbecpartners.com
• [R] plot.zoo labels   stephen sefick
• [R] plot.zoo labels   Gabor Grothendieck
• [R] plot.zoo labels   ryan.sheftel at malbecpartners.com
• [R] plot.zoo labels   Gabor Grothendieck
• [R] Plotting Bi-Gamma Distribution   Gundala Viswanath
• [R] Plotting Bi-Gamma Distribution   Ben Bolker
• [R] Plotting Bi-Gamma Distribution   Gundala Viswanath
• [R] Plotting Bi-Gamma Distribution   Wolfgang Raffelsberger
• [R] plotting granular data   Neil Gupta
• [R] plotting granular data   jim holtman
• [R] plotting granular data   Jim Lemon
• [R] Plotting Multiple lines on one plot   R_Learner
• [R] Plotting Multiple lines on one plot   RichardP
• [R] Plotting Multiple lines on one plot   hadley wickham
• [R] Plotting Prediction Surface with persp()   Rory Winston
• [R] Plotting Prediction Surface with persp()   Duncan Murdoch
• [R] Plotting Prediction Surface with persp()   rory.winston at gmail.com
• [R] png() does not generate a 24 bit PNG file   Fán Lóng
• [R] Point-biserial correlation   Angelo Scozzarella
• [R] Point-biserial correlation   Tobias Verbeke
• [R] Point-biserial correlation   William Revelle
• [R] Polynomial Approximation with Exponential Kernel   CJ Jackson
• [R] Port package   Jos Kaefer
• [R] Port package   roger koenker
• [R] Port package   Katharine Mullen
• [R] Port package   roger koenker
• [R] Port package   Ben Bolker
• [R] Port package   hadley wickham
• [R] portfolio optimization problem - use R   fzp2008
• [R] portfolio optimization problem - use R   José Augusto Jr.
• [R] Position in a vector of the last value > n   Thaden, John J
• [R] Position in a vector of the last value > n   Henrique Dallazuanna
• [R] Position in a vector of the last value > n   jim holtman
• [R] Position in a vector of the last value > n - *SOLVED*   Thaden, John J
• [R] Position in a vector of the last value > n - *SOLVED*   jim holtman
• [R] Position in a vector of the last value > n - *SOLVED*   Thaden, John J
• [R] position legend below x-axis title   Anne-Marie Ternes
• [R] position legend below x-axis title   Gabor Grothendieck
• [R] position legend below x-axis title   Greg Snow
• [R] position of a specific character   Hua Li
• [R] position of a specific character   Erik Iverson
• [R] position of a specific character   Hua Li
• [R] position of a specific character   Prof Brian Ripley
• [R] POSIXct extract time   stephen sefick
• [R] POSIXct extract time   stephen sefick
• [R] POSIXct extract time   Henrique Dallazuanna
• [R] post hoc comparisons on NLME for longitudinal data   Humberto Dutra
• [R] predict rpart: new data has new level   Chua Siang Li
• [R] predict rpart: new data has new level   Prof Brian Ripley
• [R] predict.garch problem   Shirin Safa
• [R] Prediction with Bayesian Network?   stephanos
• [R] Prediction with Bayesian Network?   Marco Scutari
• [R] principal factor analysis   Jinsong Zhao
• [R] principal factor analysis   Hans W. Borchers
• [R] princomp loading help   Wu, Hong-Sheng
• [R] princomp loading help   Daniel Malter
• [R] princomp loading help   Bert Gunter
• [R] problem   silvia narduzzi
• [R] Problem in applying conditional looping   Nadeem Shafique
• [R] Problem in applying conditional looping   jim holtman
• [R] problem in choosing cran mirror !   deepti nigam
• [R] problem in choosing cran mirror !   Uwe Ligges
• [R] problem in choosing cran mirror !   Prof Brian Ripley
• [R] Problem in installing Biobase   Jason Lee
• [R] Problem in installing Biobase   Prof Brian Ripley
• [R] Problem installing R on openSUSE 10.3   A Ezhil
• [R] Problem installing R on openSUSE 10.3   Detlef Steuer
• [R] Problem installing R on openSUSE 10.3   A Ezhil
• [R] Problem installing R on openSUSE 10.3   Detlef Steuer
• [R] Problem reading a CSV   Paulo Barata
• [R] Problem reading a CSV   Jim Porzak
• [R] Problem reading a particular file with read.spss()   Chuck Cleland
• [R] Problem reading a particular file with read.spss()   Prof Brian Ripley
• [R] Problem reading from a data frame   naw3 at duke.edu
• [R] Problem reading from a data frame   Jorge Ivan Velez
• [R] Problem reading from a data frame   jim holtman
• [R] Problem reading from a data frame   Marc Schwartz
• [R] Problem solved: extracting values from a "by" function   Daniel Stahl
• [R] Problem when building a test R package on PC   Briantgr
• [R] Problem with GLS dwtest function   mm745 at st-andrews.ac.uk
• [R] problem with lm and predict - no predictions made   Keld Jørn Simonsen
• [R] problem with lm and predict - no predictions made   Erik Iverson
• [R] problem with lm and predict - no predictions made   Jorge Ivan Velez
• [R] problem with lm and predict - no predictions made   Keld Jørn Simonsen
• [R] problem with lm and predict - no predictions made   Petr PIKAL
• [R] problem with lm and predict - no predictions made   Keld Jørn Simonsen
• [R] Problem with loading library-ks   Mayukh Dass
• [R] Problem with loading library-ks   Uwe Ligges
• [R] Problem with loading library-ks   Prof Brian Ripley
• [R] Problem with mpi.close.Rslaves()   Lyman, Mark
• [R] Problem with mpi.close.Rslaves()   Lyman, Mark
• [R] problem with mpiexec and Rmpi   Erin Hodgess
• [R] problem with mpiexec and Rmpi   Martin Morgan
• [R] problem with mpiexec and Rmpi   Dirk Eddelbuettel
• [R] problem with mpiexec and Rmpi   Dirk Eddelbuettel
• [R] problem with NA and if   Keld Jørn Simonsen
• [R] problem with NA and if   Andrew Robinson
• [R] problem with NA and if   Albert Greinoecker
• [R] problem with NA and if   Bill.Venables at csiro.au
• [R] problem with NA and if   Keld J?rn Simonsen
• [R] problem with nested loops   Jens Oldeland
• [R] problem with nested loops   Kenn Konstabel
• [R] problem with putting text in outer margins (mtext outer=TRUE)   jim holtman
• [R] problem with putting text in outer margins (mtext outer=TRUE)   Janet Young
• [R] problem with read.table   carol white
• [R] problem with read.table   carol white
• [R] problem with read.table   jim holtman
• [R] problem with read.table()   Birgitle
• [R] problem with read.table()   Philipp Pagel
• [R] problem with read.table()   Birgitle
• [R] Problem with scatterplot3d example   Tom La Bone
• [R] Problem with scatterplot3d example   Duncan Murdoch
• [R] Problem with scatterplot3d example   Uwe Ligges
• [R] Problem with strucchange package   tolga.i.uzuner at jpmorgan.com
• [R] Problem with strucchange package   Achim Zeileis
• [R] Problem with strucchange package   tolga.i.uzuner at jpmorgan.com
• [R] Problem with strucchange package   tolga.i.uzuner at jpmorgan.com
• [R] Problem with the installation of "install R" on Sun Solaris   Prof Brian Ripley
• [R] Problem with TLC/TK on Ubuntu   Davide Massidda
• [R] Problem with TLC/TK on Ubuntu   Dirk Eddelbuettel
• [R] Problem with TLC/TK on Ubuntu   Erik Iverson
• [R] Problem with TLC/TK on Ubuntu   Davide Massidda
• [R] Problem with TLC/TK on Ubuntu   Roland Rau
• [R] probleme with R CMD check   Christophe Genolini
• [R] probleme with R CMD check   Martin Maechler
• [R] probleme with R CMD check   cgenolin at u-paris10.fr
• [R] problems using mice()   Birgitle
• [R] Problems with lm()   Hsin-Ya Lee
• [R] Problems with lm()   Chibisi Chima-Okereke
• [R] Problems with lm()   Daniel Malter
• [R] Problems with lm()   Chibisi Chima-Okereke
• [R] Problems with lm()   Christoph Scherber
• [R] Problems with Package Installation.   hippie dream
• [R] Problems with Package Installation.   Erik Iverson
• [R] Problems with Package Installation.   Rolf Turner
• [R] Problems with Rmpi and LAM 7.1.4   giuseppe1.milicia at hsbcib.com
• [R] problems with rq.fit.sfn   alessia matano
• [R] problems with rq.fit.sfn   alessia matano
• [R] Processing 10^8 rows and 1^3 columns   Daren Tan
• [R] Processing 10^8 rows and 1^3 columns   Gabor Grothendieck
• [R] product of successive rows   rcoder
• [R] product of successive rows   jim holtman
• [R] product of successive rows   Patrizio Frederic
• [R] product of successive rows   Moshe Olshansky
• [R] product of successive rows   Jorge Ivan Velez
• [R] Proxy again, this time on a Mac   LostInTimeAndSpace
• [R] Proxy again, this time on a Mac   Prof Brian Ripley
• [R] pvclust   Eben Goodale
• [R] Q re iterating a process and appending results to output file   jim holtman
• [R] Q re iterating a process and appending results to output file   Eric C Banfield
• [R] Q re iterating a process and appending results to output file   Eric C Banfield
• [R] quantile regression estimation results   Emili Tortosa-Ausina
• [R] quantile regression estimation results   roger koenker
• [R] Quantitative analysis of non-standard scatter plots.   Firas Swidan
• [R] Quantitative analysis of non-standard scatter plots.   Ben Bolker
• [R] Quantitative analysis of non-standard scatter plots.   Bogaso Cristofer
• [R] Quantitative analysis of non-standard scatter plots.   Firas Swidan, PhD
• [R] Quantitative analysis of non-standard scatter plots.   Daniel Folkinshteyn
• [R] Query about finding correlations   Stefan Grosse
• [R] Query about finding correlations   Stefan Grosse
• [R] Query on packages for Emerging Patterns   Jason Lee
• [R] question about a small "for" loop   Wolfgang Huber
• [R] question about a small "for" loop   milton ruser
• [R] question about a small "for" loop   Christopher W. Ryan
• [R] question about a small "for" loop   Christopher W. Ryan
• [R] question about cmprsk library   phguardiol at aol.com
• [R] Question about GCL function   Peter Flom
• [R] question about krige code in R   Alessandro
• [R] question about krige code in R   Roger Bivand
• [R] Question about the SSOAP package   Aiste Aistike
• [R] Question concerning Furness iteration & subprogram/modules   Mario Cools
• [R] question on dispersion parameter   jpl
• [R] question on FARIMA innovations   otunno at CLEMSON.EDU
• [R] question on lm or glm matrix of coeficients X test data terms   Jorge Ivan Velez
• [R] question on lm or glm matrix of coeficients X test data terms   DS
• [R] question on lm or glm matrix of coeficients X test data terms   DS
• [R] question on lm or glm matrix of coeficients X test data terms   DS
• [R] question on lm or glm matrix of coeficients X test data terms   DS
• [R] question on lm or glm matrix of coeficients X test data terms   DS
• [R] Question regarding lmer vs glmmPQL vs glmm.admb model on a negative binomial distributed dependent variable   eugen pircalabelu
• [R] Question regarding lu in package Matrix   Ulrike Grömping
• [R] Question regarding lu in package Matrix   Douglas Bates
• [R] Question regarding lu in package Matrix   Ulrike Grömping
• [R] Question regarding statisticians   Max
• [R] Question: Beginner stuck in a R cycle   Daniela Ottaviani
• [R] Question: Beginner stuck in a R cycle   Greg Snow
• [R] Question: Beginner stuck in a R cycle   (Ted Harding)
• [R] Question: Beginner stuck in a R cycle   Gustaf Rydevik
• [R] Question: Beginner stuck in a R cycle   Rashid Nassar
• [R] Question: Beginner stuck in a R cycle   Jorge Ivan Velez
• [R] Question: Beginner stuck in a R cycle   Giovanni Petris
• [R] Question: how to build a subset to do separate calculations   Spencer
• [R] Question: how to build a subset to do separate calculations   Erik Iverson
• [R] Question: how to build a subset to do separate calculations   Erik Iverson
• [R] Question: how to build a subset to do separate calculations   stephen sefick
• [R] Question: how to build a subset to do separate calculations   stephen sefick
• [R] Questions on weighted least squares   Zhang Yanwei - Princeton-MRAm
• [R] Questions on weighted least squares   Zhang Yanwei - Princeton-MRAm
• [R] Questions on weighted least squares   Zhang Yanwei - Princeton-MRAm
• [R] Quick plotmath question   Mike Lawrence
• [R] Quick plotmath question   Christian Ritz
• [R] Quick plotmath question   Gabor Grothendieck
• [R] Quick plotmath question   Gabor Grothendieck
• [R] Quick plotmath question   Mike Lawrence
• [R] R -Legality Question about R's Open Source GNU GPL Licen   (Ted Harding)
• [R] R -Legality Question about R's Open Source GNU GPL Licen   Csardi Gabor
• [R] R -Legality Question about R's Open Source GNU GPL License   Ajay ohri
• [R] R -Legality Question about R's Open Source GNU GPL License   Stevens, Martin Henry H. Dr.
• [R] R -Legality Question about R's Open Source GNU GPL License   Marc Schwartz
• [R] R -Legality Question about R's Open Source GNU GPL License   Marc Schwartz
• [R] R -Legality Question about R's Open Source GNU GPL License   Roland Rau
• [R] R -Legality Question about R's Open Source GNU GPL License   ohri2007 at gmail.com
• [R] R -Legality Question about R's Open Source GNU GPL License   Marc Schwartz
• [R] R -Legality Question about R's Open Source GNU GPL License   ohri2007 at gmail.com
• [R] R -Legality Question about R's Open Source GNU GPL License   Gavin Simpson
• [R] R -Legality Question about R's Open Source GNU GPL License   Gavin Simpson
• [R] R bug in the update of nlme?   Susana Esteves
• [R] R bug in the update of nlme?   Spencer Graves
• [R] R command history -- can it be like Matlab's?   losemind
• [R] R command history -- can it be like Matlab's?   Prof Brian Ripley
• [R] R command history -- can it be like Matlab's?   hadley wickham
• [R] R command history -- can it be like Matlab's?   Rolf Turner
• [R] R command history -- can it be like Matlab's?   hadley wickham
• [R] R command history -- can it be like Matlab's?   losemind
• [R] R command history -- can it be like Matlab's?   Spencer Graves
• [R] R command history -- can it be like Matlab's?   Martin Maechler
• [R] R command history -- can it be like Matlab's?   Gad Abraham
• [R] R command history -- can it be like Matlab's?   bartjoosen
• [R] R command history -- can it be like Matlab's?   losemind
• [R] R Commander question   Darin Brooks
• [R] R Commander question   John Kane
• [R] R Commander question   Darin Brooks
• [R] R crash with ATLAS precompiled Rblas.dll on Windows XP Core2 Duo   Law, Jason
• [R] R crash with ATLAS precompiled Rblas.dll on Windows XP Core2 Duo   Prof Brian Ripley
• [R] R crash with ATLAS precompiled Rblas.dll on Windows XP Core2 Duo   Uwe Ligges
• [R] R GUI help   Tom.O
• [R] R interprets symbol as q()   Roger Leenders
• [R] R interprets symbol as q()   jim holtman
• [R] R interprets symbol as q()   Dieter Menne
• [R] R logo   Christophe Genolini
• [R] R logo   Martin Maechler
• [R] R logo   cgenolin at u-paris10.fr
• [R] R logo   stefano iacus
• [R] R logo   Christophe Genolini
• [R] R package   Sergi M.Garrido
• [R] R package   Duncan Murdoch
• [R] R package   Prof Brian Ripley
• [R] R version 2.7.1 (warnings)   Van Wyk, Jaap
• [R] R version 2.7.1 (warnings)   Mark Difford
• [R] R version 2.7.1 (warnings)   Van Wyk, Jaap
• [R] R version 2.7.1 (warnings)   Mark Difford
• [R] R-help Digest, Vol 65, Issue 4   José Ignacio Bustos Melo
• [R] R-help Digest, Vol 65, Issue 4   José Ignacio Bustos Melo
• [R] R-outlet: Journal of Statistical Software   Jan de Leeuw
• [R] R-package install   cindy Guo
• [R] R-package install   Mark Difford
• [R] R-package install   cindy Guo
• [R] R-package install   Prof Brian Ripley
• [R] R-package install   cindy Guo
• [R] R-package install   Prof Brian Ripley
• [R] R-package install   Uwe Ligges
• [R] R-pmg (poor man gui) question   Ferry
• [R] R-source code of a function   arezoo bagheri
• [R] R-source code of a function   Duncan Murdoch
• [R] R2WinBUGS problem   Troels Ring
• [R] R2WinBUGS problem   Troels Ring
• [R] R2WinBUGS problem   Uwe Ligges
• [R] R: create multi windows plot at the same time   Alessandro
• [R] R: create multi windows plot at the same time   ctu at bigred.unl.edu
• [R] R: gstat problem with lidar data   Dylan Beaudette
• [R] R: R: gstat problem with lidar data   Alessandro
• [R] r^2 for SSasymp?   Robert Terwilliger
• [R] Random effects and lme4   wmh
• [R] random effects mixed model, different regressors   Fensis
• [R] Random Forest %var(y)   David Katz
• [R] Random Forest %var(y)   Liaw, Andy
• [R] Random number generation   Max
• [R] Random number generation   David Barron
• [R] Random number generation   Marc Schwartz
• [R] Random number generation   Jorge Ivan Velez
• [R] Random number generation   Patrizio Frederic
• [R] Random number generation   Max
• [R] Random number generation   Max
• [R] Random subset   Alessandro
• [R] Random subset   John Kane
• [R] Random subset   Roland Rau
• [R] Random subset   Marc Schwartz
• [R] Random subset   Marc Schwartz
• [R] Random subset   Roland Rau
• [R] randomForest outlier   Birgitle
• [R] randomForest outlier   Liaw, Andy
• [R] randomForest outlier   Birgit Lemcke
• [R] randomForest outlier   Birgit Lemcke
• [R] randomForest training error   Soumyadeep Nandi
• [R] randomForest Tutorial   Dirk Nemitz
• [R] randomForest Tutorial   Jim Porzak
• [R] randomForest Tutorial   Hans W. Borchers
• [R] randomForest.error: length of response must be the same as predictors   Gavin Simpson
• [R] randomForest.error: length of response must be the same as predictors   Soumyadeep Nandi
• [R] randomForest.error: length of response must be the same as predictors   Soumyadeep Nandi
• [R] Randomly drawing observations from factors.   Economics Guy
• [R] Randomly drawing observations from factors.   Marc Schwartz
• [R] randomly select duplicated entries   Juliet Hannah
• [R] randomly select duplicated entries   Henrique Dallazuanna
• [R] randomly select duplicated entries   jim holtman
• [R] randomly select duplicated entries   Marc Schwartz
• [R] rbinom for a matrix   ACroske
• [R] rbinom for a matrix   Erik Iverson
• [R] rbinom for a matrix   Ben Bolker
• [R] rbinom for a matrix   Dylan Beaudette
• [R] rbinom for a matrix   ACroske
• [R] rbinom for a matrix   Ben Bolker
• [R] rbinom for a matrix   ACroske
• [R] rbinom for a matrix   Dylan Beaudette
• [R] rbinom for a matrix   Ben Bolker
• [R] Re gression between adjacent columns - error with NAs   rcoder
• [R] Re peated Measure ANOVA-Old question   Mark Difford
• [R] Re peated Measure ANOVA-Old question   Gavin Simpson
• [R] Re : float and double precision with C code   JS Ubei
• [R] Re : Re : float and double precision with C code   JS Ubei
• [R] re ad and check table   mysimbaa
• [R] re ad and check table   Henrique Dallazuanna
• [R] Re ad in a file - produce independent vectors   jimineep
• [R] Re ad in a file - produce independent vectors   Gabor Grothendieck
• [R] Re ad in a file - produce independent vectors   Marc Schwartz
• [R] Re ad in a file - produce independent vectors   Prof Brian Ripley
• [R] Re ad Table   jim holtman
• [R] re ad.table problem   Schleuh
• [R] Re creating Procrustes Plot in Lattice   Andrewjohnclose
• [R] Re creating Procrustes Plot in Lattice   Gavin Simpson
• [R] Re creating Procrustes Plot in Lattice   Dylan Beaudette
• [R] Re creating Procrustes Plot in Lattice   Gavin Simpson
• [R] re cursively divide a value to get a sequence   bartjoosen
• [R] Re gression between adjacent columns - error with NAs   rcoder
• [R] Re gression between adjacent columns - error with NAs   Krzysztof Sakrejda-Leavitt
• [R] Re gression between adjacent columns - error with NAs   Gabor Grothendieck
• [R] Re gression between columns in matrix - with some/full NAs   rcoder
• [R] Re membering the last time an event occurred within a dataframe   Gabor Grothendieck
• [R] Re membering the last time an event occurred within a dataframe   Henrique Dallazuanna
• [R] Re membering the last time an event occurred within a dataframe   Duncan Murdoch
• [R] Re membering the last time an event occurred within a dataframe   Jim Price
• [R] Re membering the last time an event occurred within a dataframe   Jim Price
• [R] Re peated Measure ANOVA-Old question   Mark Difford
• [R] Re peated Measure ANOVA-Old question   ctu at bigred.unl.edu
• [R] re sponse surface analysis   Tom La Bone
• [R] RE volution   Mariana Gamb
• [R] read XML   Paulo Cardoso
• [R] read XML   Martin Morgan
• [R] read XML   Paulo Cardoso
• [R] read XML   Martin Morgan
• [R] Read.table - Less rows than original data   phoebe kong
• [R] Read.table - Less rows than original data   Ben Bolker
• [R] Read.table - Less rows than original data   Philipp Pagel
• [R] read.table problem   phoebe kong
• [R] read.table question   Edna Bell
• [R] read.table question   Rolf Turner
• [R] read.table, NA assignment, and sep   Juliet Hannah
• [R] read.table, NA assignment, and sep   Peter Dalgaard
• [R] Reading CSV file with unequal record length   Viswanathan Shankar
• [R] Reading CSV file with unequal record length   Marc Schwartz
• [R] Reading CSV file with unequal record length   Peter Dalgaard
• [R] reading in a subset of a large data set   Stacey Burrows
• [R] reading in a subset of a large data set   jim holtman
• [R] reading in a subset of a large data set   Bert Gunter
• [R] Reading Multi-value data fields for descriptive analysis   Hohm, Dale
• [R] Reading Multi-value data fields for descriptive analysis   jim holtman
• [R] Reading Multi-value data fields for descriptive analysis   Hohm, Dale
• [R] Reading Multi-value data fields for descriptive analysis   jim holtman
• [R] Reading Multi-value data fields for descriptive analysis   Hohm, Dale
• [R] Reading Multi-value data fields for descriptive analysis   jim holtman
• [R] Reading Multi-value data fields for descriptive analysis (resend)   Hohm, Dale
• [R] Reading SPSS .por files   Jose Iparraguirre D'Elia
• [R] Reading SPSS .por files   Prof Brian Ripley
• [R] Reading SPSS .por files   Jose Iparraguirre D'Elia
• [R] Reading SPSS .por files   Prof Brian Ripley
• [R] Reading SPSS .por files   Jose Iparraguirre D'Elia
• [R] Reading SPSS .por files   Prof Brian Ripley
• [R] Reading SPSS .por files   Peter Dalgaard
• [R] Reading SPSS .por files   Jose Iparraguirre D'Elia
• [R] Reading the data from specific columns   Vidhu Choudhary
• [R] Reading the data from specific columns   Henrique Dallazuanna
• [R] Rearranging Data   Jia Ying Mei
• [R] Rearranging Data   Jia Ying Mei
• [R] Recoding   Agustin Lobo
• [R] Recoding a variable   Spencer
• [R] Recoding a variable   jim holtman
• [R] Recoding a variable   Stephan Kolassa
• [R] Recoding a variable   John Fox
• [R] Recoding a variable   Peter Dalgaard
• [R] recursively divide a value to get a sequence   Anne-Marie Ternes
• [R] recursively divide a value to get a sequence   Daniel Malter
• [R] recursively divide a value to get a sequence   Jim Lemon
• [R] recursively divide a value to get a sequence   Keith Jewell
• [R] recursively divide a value to get a sequence   Anne-Marie Ternes
• [R] recursively divide a value to get a sequence   Gabor Grothendieck
• [R] recursively divide a value to get a sequence   Berwin A Turlach
• [R] recursively divide a value to get a sequence   René Capell
• [R] recursively divide a value to get a sequence   Wacek Kusnierczyk
• [R] recursively divide a value to get a sequence   Carl Witthoft
• [R] recursively divide a value to get a sequence   Erik Iverson
• [R] reference in article   Peter Dalgaard
• [R] Regression and fitting   Gunther Höning
• [R] Regression and fitting   ONKELINX, Thierry
• [R] Regression and fitting   Gunther Höning
• [R] Regression problem   Angila Albaros
• [R] Regression problem   Patrick Burns
• [R] Regression problem   Douglas Bates
• [R] Regression problem   Erik Iverson
• [R] Regression problem   Angila Albaros
• [R] Regular expressions: bug or misunderstanding?   Duncan Murdoch
• [R] Regular expressions: bug or misunderstanding?   (Ted Harding)
• [R] Regular expressions: bug or misunderstanding?   Duncan Murdoch
• [R] Regular expressions: bug or misunderstanding?   Gabor Grothendieck
• [R] Regular expressions: bug or misunderstanding?   Gabor Grothendieck
• [R] Regular expressions: bug or misunderstanding?   Duncan Murdoch
• [R] Relative Mortality Risk second part   José Ignacio Bustos Melo
• [R] Relative Mortality Risk second part   Marc Schwartz
• [R] Relative Mortality Risk second part   Terry Therneau
• [R] Relying on R to generate html tables with hyperlinks and pictures ?   Jim Lemon
• [R] Relying on R to generate html tables with hyperlinks and pictures ?   Daren Tan
• [R] Remove non-numerical columns from data frame   Markus Mühlbacher
• [R] Remove non-numerical columns from data frame   Henrique Dallazuanna
• [R] Remove non-numerical columns from data frame   Peter Dalgaard
• [R] Remove non-numerical columns from data frame   Henrik Bengtsson
• [R] Removing or overwriting an XML node   Steffen Neumann
• [R] Removing or overwriting an XML subtree   Steffen Neumann
• [R] Removing script file   Dennis Fisher
• [R] Removing script file   Prof Brian Ripley
• [R] Repeated Measure ANOVA-Old question   ctu at bigred.unl.edu
• [R] Repeated measures lme or anova   John Coulthard
• [R] Repeated measures lme or anova   Martin Henry H. Stevens
• [R] Repeated measures lme or anova   hadley wickham
• [R] replacing value in column of data frame   Booman, M
• [R] replacing value in column of data frame   Daniel Malter
• [R] replacing value in column of data frame   jim holtman
• [R] replicate matrix blocks different numbers of times into new matrix   Ralph S.
• [R] replicate matrix blocks different numbers of times into new matrix   jim holtman
• [R] replicate matrix blocks different numbers of times into new matrix   Peter Dalgaard
• [R] replicate matrix blocks different numbers of times into new matrix   Ralph S.
• [R] replicate matrix blocks different numbers of times into new matrix   Ralph S.
• [R] Reproducibility and GUIs   roger koenker
• [R] RES: Error while plotting matrix   Leandro Marino
• [R] RES: initialize a matrix   Leandro Marino
• [R] RES: "Invalid object" error in boxplot   Leandro Marino
• [R] RES: Change name of a specific column of a data frame   Leandro Marino
• [R] RES: Colours in R   Leandro Marino
• [R] RES: plot window   Leandro Marino
• [R] RES: Simple... but...   Leandro Marino
• [R] RES: Sum(Random Numbers)=100   Leandro Marino
• [R] RES: WIERD: Basic computing in R   Leandro Marino
• [R] RES: bug in axis.Date? was (Re: newbie needs help plotting timeseries)   Leandro Marino
• [R] RES: how to automatically maximize the graph window (under XP) ?   Leandro Marino
• [R] RES: Need ideas on how to show spikes in my data and how to codeit in R   Thomas Frööjd
• [R] reshape matrices   Francisco Javier Santos Alamillos
• [R] reshape matrices   Francisco Javier Santos Alamillos
• [R] reshape matrices   jim holtman
• [R] reshape matrices   Marc Schwartz
• [R] response surface analysis   Jinsong Zhao
• [R] response surface analysis   milton ruser
• [R] response surface analysis   Jinsong Zhao
• [R] Resshufling algorithm (Thiago Souza)   Thiago Souza
• [R] Resshufling algorithm (Thiago Souza)   Bernardo Rangel Tura
• [R] Retain plot?   rkevinburton at charter.net
• [R] Retain plot?   ONKELINX, Thierry
• [R] Retrieving data from a tcl /tk function   Judith Flores
• [R] REvolution computing   Mariana Carla Gambarotta
• [R] REvolution computing   Marc Schwartz
• [R] REvolution computing   David Henderson
• [R] REvolution computing   Gregory R. Warnes
• [R] REvolution computing   Uwe Ligges
• [R] REvolution computing   Charles Annis, P.E.
• [R] REvolution computing   Warnes, Gregory R.
• [R] Rf_error crashes entire program.   Andrew Redd
• [R] Rf_error crashes entire program.   Duncan Murdoch
• [R] Rf_error crashes entire program.   Andrew Redd
• [R] Rf_error crashes entire program.   Prof Brian Ripley
• [R] rgl.snapshot on linux produces colored lines only   Matt
• [R] rJava crashes jvm   Christian Ruckert
• [R] RJDBC and OracleDriver: unable to connect   Rodrigo Santamaria
• [R] rm anova   korhan ozkan
• [R] rm(l*)   Oehler, Friderike (AGPP)
• [R] rm(l*)   Gabor Csardi
• [R] rm(l*)   Prof Brian Ripley
• [R] Rmpi unkown input format error   Lyman, Mark
• [R] RODBC - problems using odbcDriverConnect without DSN   Josiah Walker
• [R] RODBC - problems using odbcDriverConnect without DSN   Prof Brian Ripley
• [R] RODBC Access limit?   HBaize
• [R] RODBC Access limit?   ONKELINX, Thierry
• [R] RODBC to query an Oracle table   Megan J Bellamy
• [R] RODBC to query an Oracle table   Marc Schwartz
• [R] RODBC to query an Oracle table   Prof Brian Ripley
• [R] RODBC to query an Oracle table   Jim Porzak
• [R] RODBC to query an Oracle table   David Scott
• [R] rollapply() opertation on time series   rcoder
• [R] rollapply() opertation on time series   Gabor Grothendieck
• [R] rollapply() opertation on time series   Gabor Grothendieck
• [R] rollapply() opertation on time series   rcoder
• [R] rollapply() opertation on time series   Gabor Grothendieck
• [R] rollapply() opertation on ts matrix   rcoder
• [R] rollapply() to portions of a matrix   rcoder
• [R] rollapply() to portions of a matrix   Gabor Grothendieck
• [R] Rolling range and regression calculations   rcoder
• [R] Rolling range and regression calculations   Achim Zeileis
• [R] Rolling range and regression calculations   rcoder
• [R] Rolling range and regression calculations   stephen sefick
• [R] Rolling range and regression calculations   rcoder
• [R] Rolling range and regression calculations   stephen sefick
• [R] Rolling range and regression calculations   Gabor Grothendieck
• [R] Rolling regression - o/p selected coefficients   rcoder
• [R] rolling regression between adjacent columns   rcoder
• [R] rolling regression between adjacent columns   Gabor Grothendieck
• [R] rolling regression between adjacent columns   rcoder
• [R] rolling regression between adjacent columns   Gabor Grothendieck
• [R] rollmean and stl   stephen sefick
• [R] rollmean and stl   Achim Zeileis
• [R] rollmean()   Rheannon
• [R] rollmean()   Gabor Grothendieck
• [R] rollmean()   stephen sefick
• [R] rounding   Korn, Ed (NIH/NCI) [E]
• [R] rounding   Rolf Turner
• [R] rounding   ctu at bigred.unl.edu
• [R] rounding   Moshe Olshansky
• [R] rounding   Moshe Olshansky
• [R] rounding   jim holtman
• [R] rounding   Jim Lemon
• [R] Row Sum, exclude positive values   Rheannon
• [R] Row Sum, exclude positive values   Jorge Ivan Velez
• [R] Row Sum, exclude positive values   Jim Lemon
• [R] Row Sum, exclude positive values   Nordlund, Dan (DSHS/RDA)
• [R] rpart confidence intervals?   RichardP
• [R] rpart confidence intervals?   Richard Pearson
• [R] rpart node number   Chua Siang Li
• [R] rpart$where and predict.rpart   Chua Siang Li
• [R] rpart$where and predict.rpart   Prof Brian Ripley
• [R] rpart$where and predict.rpart   Chua Siang Li
• [R] Rprintf will not build in my C++ compiler   nmarti
• [R] Rprintf will not build in my C++ compiler   Prof Brian Ripley
• [R] Rprintf will not build in my C++ compiler   nmarti
• [R] RSQLite maximum table size   Vidhu Choudhary
• [R] RSQLite maximum table size   Gabor Grothendieck
• [R] RStat version 2.7.2 now available   Gregory R. Warnes
• [R] RStem with portuguese language   Paulo Cortez
• [R] RStem with portuguese language   Duncan Temple Lang
• [R] Running "all possible subsets" of a GLM (binomial) model   Eric Vander Wal
• [R] Running "all possible subsets" of a GLM (binomial) model   hadley wickham
• [R] Running "all possible subsets" of a GLM (binomial) model   Ben Bolker
• [R] Rv: Chi-square parameter estimation   Julio Rojas
• [R] S 3 generic method consistency warning please help   stephen sefick
• [R] S 3 generic method consistency warning please help   Gabor Grothendieck
• [R] S 3 generic method consistency warning please help   stephen sefick
• [R] S 3 generic method consistency warning please help   stephen sefick
• [R] S-PLUS code in R   Fotis Papailias
• [R] S-PLUS code in R   Duncan Murdoch
• [R] S-PLUS code in R   Fotis Papailias
• [R] S-PLUS code in R   Fotis Papailias
• [R] S-PLUS code in R   Fotis Papailias
• [R] s-plus in R... simpler code   Fotis Papailias
• [R] S4 : setGeneric for classical methods   cgenolin at u-paris10.fr
• [R] S4 : setGeneric for classical methods   Prof Brian Ripley
• [R] S4 : setGeneric for classical methods   cgenolin at u-paris10.fr
• [R] S4 : setGeneric for classical methods   Martin Maechler
• [R] S4 : setGeneric for classical methods   cgenolin at u-paris10.fr
• [R] S4 : setGeneric for classical methods   Martin Maechler
• [R] S4 : setGeneric for classical methods   cgenolin at u-paris10.fr
• [R] S4 : setGeneric for classical methods   Martin Maechler
• [R] S4 : setGeneric for classical methods   cgenolin at u-paris10.fr
• [R] S4 class and Package NAMESPACE [NC]   Sylvain ARCHENAULT
• [R] S4 class and Package NAMESPACE [NC]   Martin Morgan
• [R] S4 class questions   Li, Xuejun
• [R] S4 class questions   Martin Morgan
• [R] Sample   Raphael Saldanha
• [R] Sample   jim holtman
• [R] Sample   (Ted Harding)
• [R] Sample   Raphael Saldanha
• [R] Sample on dataframe   Jarekj
• [R] Sample on dataframe   milton ruser
• [R] Sample on dataframe   Prof Brian Ripley
• [R] Sample on dataframe   Jarekj
• [R] Sampling distribution (PDF & CDF) of correlation   Mike Lawrence
• [R] Sampling distribution (PDF & CDF) of correlation   Maria Rizzo
• [R] Sampling distribution (PDF & CDF) of correlation   Charles C. Berry
• [R] sampling from a list of values while excluding one   Juliane Struve
• [R] sampling from a list of values while excluding one   jim holtman
• [R] sampling from a list of values while excluding one   Juliane Struve
• [R] Sampling two exponentials   Zhang Yanwei - Princeton-MRAm
• [R] Sampling two exponentials   Ben Bolker
• [R] Sampling two exponentials   Moshe Olshansky
• [R] Sampling two exponentials   Zhang Yanwei - Princeton-MRAm
• [R] Sampling two exponentials   Ben Bolker
• [R] Sampling two exponentials   Zhang Yanwei - Princeton-MRAm
• [R] Saving a workspace with "extras"?   J.delasHeras at ed.ac.uk
• [R] Saving a workspace with "extras"?   Sarah Goslee
• [R] Saving a workspace with "extras"?   J.delasHeras at ed.ac.uk
• [R] saving plot both as jpg and pdf   Monica Pisica
• [R] saving plot both as jpg and pdf   stephen sefick
• [R] saving plot both as jpg and pdf   Greg Snow
• [R] saving plot both as jpg and pdf   Monica Pisica
• [R] saving plot both as jpg and pdf   Tomas Lanczos
• [R] scatter plot using ggplot   Megh Dal
• [R] scatter plot using ggplot   hadley wickham
• [R] scatter plot using ggplot   Megh Dal
• [R] scatter plot using ggplot   ONKELINX, Thierry
• [R] Scatterplot matrix one column vs. the rest of the dataset   stephen sefick
• [R] Scatterplot matrix one column vs. the rest of the dataset   stephen sefick
• [R] SciViews GUI   Felipe Carrillo
• [R] SciViews GUI   Philippe Grosjean
• [R] search with help.start   Carlisle Thacker
• [R] search with help.start   Marc Schwartz
• [R] select significant variables   闫梅
• [R] select.list() cannot be used non-interactively   Fabio Fanoni
• [R] select.list() cannot be used non-interactively   Prof Brian Ripley
• [R] Selecting the first measurement only from a longitudinal sequence   john james
• [R] Selecting the first measurement only from a longitudinal sequence   jim holtman
• [R] sem & testing multiple hypotheses with BIC   Donald Braman
• [R] sem & testing multiple hypotheses with BIC   John Fox
• [R] sequential sum of a vector...   Shubha Vishwanath Karanth
• [R] sequential sum of a vector...   Jorge Ivan Velez
• [R] sequential sum of a vector...   Patrizio Frederic
• [R] sequential sum of a vector...   Shubha Vishwanath Karanth
• [R] sequential sum of a vector...   William Revelle
• [R] sequential sum of a vector...   Gustaf Rydevik
• [R] sequential sum of a vector...   Marc Schwartz
• [R] sequential sum of a vector...   Richard.Cotton at hsl.gov.uk
• [R] sequential sum of a vector...   Henrique Dallazuanna
• [R] sequential sum of a vector...   denise xifaras
• [R] Set default value   Marco Salvi
• [R] Set default value   Michela Cameletti
• [R] Set default value   Erik Iverson
• [R] set type of SS in anova()   jeroenooms
• [R] set type of SS in anova()   Prof Brian Ripley
• [R] set type of SS in anova()   John Fox
• [R] set values in data.frame to NA conditional on another data.frame   Carson Farmer
• [R] setting editor environment variable EDITOR either when configuring R for installation or in .Rprofile   Mark Kimpel
• [R] setting editor environment variable EDITOR either when configuring R for installation or in .Rprofile   Mark Kimpel
• [R] setting editor environment variable EDITOR either when configuring R for installation or in .Rprofile   Marc Schwartz
• [R] setting editor environment variable EDITOR either when configuring R for installation or in .Rprofile   Prof Brian Ripley
• [R] Setting fixed size for segement plot using stars() (axes size vs print size)   Jay Douillard
• [R] shading an area in a edf   squall44
• [R] shading an area in a edf   Ray Brownrigg
• [R] shapiro wilk normality test   Bunny, lautloscrew.com
• [R] shapiro wilk normality test   Robert A LaBudde
• [R] shapiro wilk normality test   Bunny, lautloscrew.com
• [R] shapiro wilk normality test   Mark Leeds
• [R] shapiro wilk normality test   Robert A LaBudde
• [R] shapiro wilk normality test   C.H.
• [R] shapiro wilk normality test   Marta Colombo
• [R] shapiro wilk normality test   Frank E Harrell Jr
• [R] shapiro wilk normality test   (Ted Harding)
• [R] shapiro wilk normality test   Charles Annis, P.E.
• [R] shapiro wilk normality test   Berwin A Turlach
• [R] shapiro wilk normality test   (Ted Harding)
• [R] shapiro wilk normality test   Frank E Harrell Jr
• [R] shapiro wilk normality test   Johannes Huesing
• [R] shapiro wilk normality test   (Ted Harding)
• [R] shapiro wilk normality test   Johannes Huesing
• [R] shapiro wilk normality test   (Ted Harding)
• [R] shapiro wilk normality test   Greg Snow
• [R] shapiro wilk normality test   Emmanuel Charpentier
• [R] shifting data in matrix by n rows   rcoder
• [R] shifting data in matrix by n rows   jim holtman
• [R] shifting data in matrix by n rows   rcoder
• [R] shifting data in matrix by n rows   Gabor Grothendieck
• [R] shifting data in matrix by n rows   jim holtman
• [R] shifting data in matrix by n rows   rcoder
• [R] shifting data in matrix by n rows   Gabor Grothendieck
• [R] shifting data in matrix by n rows   Gabor Grothendieck
• [R] shifting data in matrix by n rows   rcoder
• [R] shifting data in matrix by n rows   Gabor Grothendieck
• [R] Should this PDF render correctly without font embedding?   Jeffrey Horner
• [R] Should this PDF render correctly without font embedding?   stephen sefick
• [R] Should this PDF render correctly without font embedding?   Rolf Turner
• [R] Should this PDF render correctly without font embedding?   (Ted Harding)
• [R] shQuote and cat   Vadim Organovich
• [R] shQuote and cat   Duncan Murdoch
• [R] Significance of confidence intervals in the Non-Linear Least Squares Program.   bbouling
• [R] simple random number generation   dxc13
• [R] simple random number generation   jim holtman
• [R] simple random number generation   Moshe Olshansky
• [R] simple random number generation   S Ellison
• [R] simple random number generation   Rolf Turner
• [R] Simple vector question.   rkevinburton at charter.net
• [R] Simple vector question.   jim holtman
• [R] Simple vector question.   rkevinburton at charter.net
• [R] Simple vector question.   jim holtman
• [R] Simple... but...   Shubha Vishwanath Karanth
• [R] Simple... but...   Doran, Harold
• [R] Simple... but...   Shubha Vishwanath Karanth
• [R] Simple... but...   Henrique Dallazuanna
• [R] Simple... but...   Shubha Vishwanath Karanth
• [R] Simple... but...   Nutter, Benjamin
• [R] Simple... but...   Doran, Harold
• [R] Simple... but...   Wacek Kusnierczyk
• [R] Simple... but...   ONKELINX, Thierry
• [R] Simple... but...   Jim Porzak
• [R] Simple... but...   Dimitris Rizopoulos
• [R] Simple... but...   (Ted Harding)
• [R] Simple... but...   Mitchell Maltenfort
• [R] Simple... but...   john seers (IFR)
• [R] Simple... but...   Doran, Harold
• [R] Simple... but...   Wacek Kusnierczyk
• [R] Simple... but...   Berwin A Turlach
• [R] Simple... but...   Prof Brian Ripley
• [R] Simple... but...   Gabor Grothendieck
• [R] Simple... but...   Gustaf Rydevik
• [R] Simple... but...   Ben Bolker
• [R] Simple... but...   Wacek Kusnierczyk
• [R] Simple... but...   Wacek Kusnierczyk
• [R] Simple... but...   Jorge Ivan Velez
• [R] simulate data for lme   melanie.r
• [R] Simulate data with binary outcome   Steve Frost
• [R] Simulate from a GAM model   Mark Lyman
• [R] Simulate from a GAM model   Gavin Simpson
• [R] Simulating multilevel responses   Elke Moons
• [R] size and coding error in plot ?   shetumi at aim.com
• [R] size and coding error in plot ?   shetumi at aim.com
• [R] size and coding error in plot ?   hadley wickham
• [R] size and coding error in plot ?   Marc Schwartz
• [R] smooth.spline   rkevinburton at charter.net
• [R] smooth.spline   Spencer Graves
• [R] smooth.spline   Roland Rau
• [R] smooth.spline   Spencer Graves
• [R] smooth.spline   rkevinburton at charter.net
• [R] smooth.spline   hadley wickham
• [R] smooth.spline   Spencer Graves
• [R] smooth.spline   Duncan Murdoch
• [R] smooth.spline   Spencer Graves
• [R] smooth.spline   rkevinburton at charter.net
• [R] sort rows of matrix by rows of another matrix   Timothy W. Hilton
• [R] Sorting / editing a table   Jörg Groß
• [R] Sorting / editing a table   Wacek Kusnierczyk
• [R] Sorting / editing a table   Daniel Malter
• [R] Sorting / editing a table   Tobias Verbeke
• [R] sorting a data frame by rownames   Michael Rennie
• [R] sorting a data frame by rownames   Rolf Turner
• [R] sorting a data frame by rownames   Jorge Ivan Velez
• [R] Sorting a list   tolga.i.uzuner at jpmorgan.com
• [R] Sorting a list   Peter Dalgaard
• [R] Sorting a list   milton ruser
• [R] Sorting a matrix   Angelo Scozzarella
• [R] Sorting a matrix   Jorge Ivan Velez
• [R] Sorting a matrix   Erik Iverson
• [R] Sorting a matrix   Bert Gunter
• [R] source code for R-dev packages   Mark Kimpel
• [R] source code for R-dev packages   Prof Brian Ripley
• [R] source code functions   stephen sefick
• [R] source code functions   Henrique Dallazuanna
• [R] source code functions   Gavin Simpson
• [R] Spatial Sample   Raphael Saldanha
• [R] spatial statistics and matrix algebra   Paulo Cardoso
• [R] Specific question on LDheatmap   Boks, M.P.M.
• [R] specifying data   sprohl at na.uni-tuebingen.de
• [R] specifying data   Daniel Malter
• [R] specifying data   hpdutra
• [R] spectral decomposition for near-singular pd matrices   Prasenjit Kapat
• [R] spectral decomposition for near-singular pd matrices   Moshe Olshansky
• [R] spectral decomposition for near-singular pd matrices   Prasenjit Kapat
• [R] spectral decomposition for near-singular pd matrices   Moshe Olshansky
• [R] speeding up loop and dealing wtih memory problems   Denise Xifara
• [R] speeding up loop and dealing wtih memory problems   David Hajage
• [R] speeding up loop and dealing wtih memory problems   jim holtman
• [R] speeding up loop and dealing wtih memory problems   ONKELINX, Thierry
• [R] speeding up loop and dealing wtih memory problems   Prof Brian Ripley
• [R] Sperman Correlation with rcorr (Hmisc)   Birgitle
• [R] spliting a string   Kurapati, Ravichandra (Ravichandra)
• [R] spliting a string   Jim Lemon
• [R] spliting a string   Wacek Kusnierczyk
• [R] SPR experiment: using lmer, transforming data, collinearity, and using a covariable   Claire Delle Luche
• [R] spreading the risk   markleeds at verizon.net
• [R] Start preferred RGui   marciarr
• [R] Start preferred RGui   Keith Jewell
• [R] Start preferred RGui   Gabor Grothendieck
• [R] Start preferred RGui   Ptit_Bleu
• [R] Start preferred RGui   bartjoosen
• [R] Start preferred RGui   Keith Jewell
• [R] Start preferred RGui   Ptit_Bleu
• [R] Start preferred RGui   John C Frain
• [R] statistics question about a statement in julian faraway's "extending the linear model with R" text   markleeds at verizon.net
• [R] statistics question about a statement in julian faraway's "extending the linear model with R" text   Greg Snow
• [R] statistics question about a statement in julian faraway's "extending the linear model with R" text   Duncan Murdoch
• [R] statistics question about a statement in julian faraway's "extending the linear model with R" text   Peter Dalgaard
• [R] stats question   Iasonas Lamprianou
• [R] stats question   Moshe Olshansky
• [R] stats question   Marc Schwartz
• [R] stats question   Iasonas Lamprianou
• [R] stem and leaf plot: how to edit the stem-values   Jörg Groß
• [R] stem and leaf plot: how to edit the stem-values   Duncan Murdoch
• [R] stem and leaf plot: how to edit the stem-values   Rolf Turner
• [R] still more dumb questions   Edna Bell
• [R] still more dumb questions   Rolf Turner
• [R] stop without error message   Eric Ferreira
• [R] stop without error message   Duncan Murdoch
• [R] Stratified random sample   lamack lamack
• [R] Stratified random sample   Rolf Turner
• [R] Stratified random sample   Daniel Malter
• [R] Stratified random sample   Rolf Turner
• [R] stringdot ?   renata.camargo05 at ntlworld.com
• [R] strip names lattice graphics   GOUACHE David
• [R] strip names lattice graphics   Deepayan Sarkar
• [R] Strptime/ date time classes   Caroline Keef
• [R] Strptime/ date time classes   jim holtman
• [R] Strptime/ date time classes   Mark Difford
• [R] Strptime/ date time classes   Caroline Keef
• [R] Strptime/ date time classes   jim holtman
• [R] Strptime/ date time classes   Gabor Grothendieck
• [R] Strptime/ date time classes   Caroline Keef
• [R] Strptime/ date time classes   Mark Difford
• [R] subscript out of bounds error.   Rajasekaramya
• [R] subscript out of bounds help   Rajasekaramya
• [R] subset function within a function   Lana Schaffer
• [R] subset function within a function   Henrique Dallazuanna
• [R] subset() multiple arguments   stephen sefick
• [R] subset() multiple arguments   Henrique Dallazuanna
• [R] subset() multiple arguments   Duncan Murdoch
• [R] subset() multiple arguments   Peter Dalgaard
• [R] Subsetting an array by a vector of dimensions   Richard Pearson
• [R] Subsetting an array by a vector of dimensions   Patrick Burns
• [R] Subsetting an array by a vector of dimensions   Richard Pearson
• [R] Subsetting an array by a vector of dimensions   Richard Pearson
• [R] Subsetting an array by a vector of dimensions   Wolfgang Huber
• [R] Subsetting an array by a vector of dimensions   Kenn Konstabel
• [R] Subsetting an array by a vector of dimensions   Wolfgang Huber
• [R] Subsetting an array by a vector of dimensions   Kenn Konstabel
• [R] Subsetting data by date   Williams, Robin
• [R] Subsetting data by date   Gabor Grothendieck
• [R] Subsetting data by date   Gabor Grothendieck
• [R] Subsetting data by date   Williams, Robin
• [R] Subsetting data by date   Williams, Robin
• [R] Subsetting data by date   John Kane
• [R] Subsetting data by date   John Kane
• [R] Subsetting data by date   Gabor Grothendieck
• [R] Successfully connected GNU R to PostgreSQL on windows XP.   Andre Cesta
• [R] sum each row and output results   Rheannon
• [R] sum each row and output results   milton ruser
• [R] sum each row and output results   Henrique Dallazuanna
• [R] Sum efficiently from large matrix according to re-occuring levels of factor?   hadley wickham
• [R] Sum efficiently from large matrix according to re-occuring levels of factor?   hadley wickham
• [R] Sum efficiently from large matrix according to re-occuring levels of factor?   jim holtman
• [R] Sum efficiently from large matrix according to re-occuring levels of factor?   hadley wickham
• [R] Sum efficiently from large matrix according to re-occuring levels of factor?   Ralph S.
• [R] Sum efficiently from large matrix according to re-occuring levels of factor?   Ralph S.
• [R] Sum efficiently from large matrix according to re-occuring levels of factor?   Ralph S.
• [R] Sum(Random Numbers)=100   Shubha Vishwanath Karanth
• [R] Sum(Random Numbers)=100   Moshe Olshansky
• [R] Sum(Random Numbers)=100   Shubha Vishwanath Karanth
• [R] Sum(Random Numbers)=100   Peng Jiang
• [R] Sum(Random Numbers)=100   Daniel Malter
• [R] Sum(Random Numbers)=100   Moshe Olshansky
• [R] Sum(Random Numbers)=100   Richard Pearson
• [R] Sum(Random Numbers)=100   Daniel Malter
• [R] Sum(Random Numbers)=100   Daniel Malter
• [R] Sum(Random Numbers)=100   Bill.Venables at csiro.au
• [R] Sum(Random Numbers)=100   Peter Dalgaard
• [R] Sum(Random Numbers)=100   Patrick Burns
• [R] Sum(Random Numbers)=100   Hanke, Alex
• [R] Sum(Random Numbers)=100   Kenn Konstabel
• [R] Sum(Random Numbers)=100   Carl Witthoft
• [R] Summary Stats (not summary(x))   nmarti
• [R] Summary Stats (not summary(x))   Jorge Ivan Velez
• [R] Summary Stats (not summary(x))   Gabor Grothendieck
• [R] Summary Stats (not summary(x))   Gabor Csardi
• [R] Summary Stats (not summary(x))   HBaize
• [R] Summary Stats (not summary(x))   nmarti
• [R] Summary Stats (not summary(x))   William Revelle
• [R] Summary Stats (not summary(x))   nmarti
• [R] Summary Stats (not summary(x))   nmarti
• [R] Summary Stats (not summary(x))   Gabor Grothendieck
• [R] sunrise sunset calculations   stephen sefick
• [R] sunrise sunset calculations   Chuck Cleland
• [R] sunrise sunset calculations   stephen sefick
• [R] Sunset in Dortmund   Marc Schwartz
• [R] Sunset in Dortmund   Johannes Huesing
• [R] Sunset in Dortmund   Marc Schwartz
• [R] Sunset in Dortmund   John Kane
• [R] Sunset in Dortmund   Marc Schwartz
• [R] Sunset in Dortmund   Uwe Ligges
• [R] Sunset in Dortmund   Johannes Huesing
• [R] Supressing printing from a function: ecdf   tolga.i.uzuner at jpmorgan.com
• [R] Supressing printing from a function: ecdf   Patrick Burns
• [R] Supressing printing from a function: ecdf   Prof Brian Ripley
• [R] Supressing printing from a function: ecdf   Ivar Herfindal
• [R] Supressing printing from a function: ecdf   tolga.i.uzuner at jpmorgan.com
• [R] Survey questions   Farley, Robert
• [R] Survey questions   Tobias Verbeke
• [R] Survival Analysis questions   Viet Le
• [R] survival package test stats   Geoffrey Smith
• [R] survival package test stats   Terry Therneau
• [R] Survival statistics--displaying multiple plots   Gregory Pierce
• [R] SVM: Graphical representation   M Perez
• [R] swap_tail macro in pnorm.c   Adam B. Thompson
• [R] Sweave / Latex per-chapter output   Anne-Marie Ternes
• [R] Sweave add code \201   Christophe Genolini
• [R] Sweave add code \201   Peter Dalgaard
• [R] Sweave add code \201   Christophe Genolini
• [R] Sweave figure   Georg Otto
• [R] Sweave figure   Duncan Murdoch
• [R] Sweave, backslash in sub pattern? was: Backslash in sub pattern?   Stephan Kolassa
• [R] Sweave, backslash in sub pattern? was: Backslash in sub pattern?   Duncan Murdoch
• [R] Sweave, backslash in sub pattern? was: Backslash in sub pattern?   Stephan Kolassa
• [R] Sweave, backslash in sub pattern? was: Backslash in sub pattern?   Marc Schwartz
• [R] synthax for R CMD INSTALL   Naiara Pinto
• [R] synthax for R CMD INSTALL   Prof Brian Ripley
• [R] System exit codes   Ranjan Bagchi
• [R] System exit codes   Ranjan Bagchi
• [R] System exit codes   Prof Brian Ripley
• [R] System exit codes   Ranjan Bagchi
• [R] system time - windows specific problem   Christophe Dutang
• [R] system time - windows specific problem   Duncan Murdoch
• [R] system time - windows specific problem   Christophe Dutang
• [R] t-test for multiple variables   Henning Wildhagen
• [R] t-test for multiple variables   Simon Anders
• [R] t-test for multiple variables   Henning Wildhagen
• [R] t-test for multiple variables   Simon Anders
• [R] Table of tables?   Rolf Turner
• [R] Table orderd by frequencies   Kunzler, Andreas
• [R] Table orderd by frequencies   Dimitris Rizopoulos
• [R] Table orderd by frequencies   Barry Rowlingson
• [R] table questions   Edna Bell
• [R] table questions   Patrizio Frederic
• [R] table questions   (Ted Harding)
• [R] table questions   (Ted Harding)
• [R] table questions   Jim Lemon
• [R] TeachingDemos question: my.symbols() alignment problems in complicated layout   hadley wickham
• [R] TeachingDemos question: my.symbols() alignment problems in complicated layout   maria at meteo.mcgill.ca
• [R] TeachingDemos question: my.symbols() alignment problems in complicated layout   Paul Murrell
• [R] TeachingDemos question: my.symbols() alignment problems in complicated layout   maria at meteo.mcgill.ca
• [R] TeachingDemos question: my.symbols() alignment problems in complicated layout   Greg Snow
• [R] tensor product of equi-spaced B-splines in the unit square   Patrizio Frederic
• [R] tensor product of equi-spaced B-splines in the unit square   Patrizio Frederic
• [R] Ternaryplot function   theBenjamin
• [R] Ternaryplot function   Rolf Turner
• [R] test for difference in variance   Anders Malmendal
• [R] Test for multiple comparisons: Nonlinear model, autocorrelation?   Spencer Graves
• [R] Test for multiple comparisons: Nonlinear model, autocorrelation?   Spencer Graves
• [R] Test for multiple comparisons: Nonlinear model, autocorrelation?   J S
• [R] Test for multiple comparisons: Nonlinear model, autocorrelation?   J S
• [R] Test for multiple comparisons: Nonlinear model, autocorrelation?   J S
• [R] TextMate and R   Angelo Scozzarella
• [R] TextMate and R   Rob Goedman
• [R] Thanks!   R_Learner
• [R] Thanks!   Marc Schwartz
• [R] Thanks!   R_Learner
• [R] Thanks!   R_Learner
• [R] Thanks!   Petr PIKAL
• [R] Thin frame line around R pdf output in LaTeX   Joseph Retzer
• [R] Thin frame line around R pdf output in LaTeX   Prof Brian Ripley
• [R] Thin frame line around R pdf output in LaTeX   Joseph Retzer
• [R] Three contrast matrices on the same linear model   Christoph Scherber
• [R] Time Series - Long Memory Estimation   Fotis Papailias
• [R] Time Series - Long Memory Estimation   Fotis Papailias
• [R] Time Series - Long Memory Estimation   Fotis Papailias
• [R] time series by calendar week   collonil
• [R] time series by calendar week   stephen sefick
• [R] time series by calendar week   Jeffrey J. Hallman
• [R] time series by calendar week   Gabor Grothendieck
• [R] Time series reliability questions   John Theal
• [R] Time series reliability questions   Achim Zeileis
• [R] time zone - best way to shift hours   DCC
• [R] time zone - best way to shift hours   Prof Brian Ripley
• [R] Tissue specific genes by ANOVA?   icebreake
• [R] Tissue specific genes by ANOVA?   icebreake
• [R] Tissue specific genes by ANOVA?   Marcelo Luiz de Laia
• [R] Tissue specific genes by ANOVA?   icebreake
• [R] Tissue specific genes by ANOVA?   Marcelo Luiz de Laia
• [R] Title for graph with multiple plots   Tolga Uzuner
• [R] Title for graph with multiple plots   jim holtman
• [R] Title for graph with multiple plots   (Ted Harding)
• [R] Title for graph with multiple plots   Tolga Uzuner
• [R] tklistbox and extracting selection to R   Judith Flores
• [R] tklistbox and extracting selection to R   Greg Snow
• [R] Tobit Estimation with Panel Data   Arne Henningsen
• [R] Tobit Estimation with Panel Data   Terry Therneau
• [R] Tobit Estimation with Panel Data   Arne Henningsen
• [R] transcript a matlab code in R   Fotis Papailias
• [R] transcript a matlab code in R   Berend Hasselman
• [R] Transfer Function Modeling   Ashish Kumar
• [R] Transfer Function Modeling   Felix Andrews
• [R] trivial list question   Boks, M.P.M.
• [R] trivial list question   Gabor Csardi
• [R] trivial list question   ONKELINX, Thierry
• [R] trivial list question   Henrique Dallazuanna
• [R] trivial list question   Kenn Konstabel
• [R] trivial list question   Wacek Kusnierczyk
• [R] truncated normal   cindy Guo
• [R] truncated normal   Duncan Murdoch
• [R] truncated normal   Duncan Murdoch
• [R] truncated normal   Duncan Murdoch
• [R] truncated normal   Berwin A Turlach
• [R] try question   Edna Bell
• [R] try question   Richard.Cotton at hsl.gov.uk
• [R] try question   Prof Brian Ripley
• [R] try question   Mike Prager
• [R] tryCatch - return from function to main script   Anne-Marie Ternes
• [R] tryCatch - return from function to main script   jim holtman
• [R] trying to superimpose a line plot onto a histogram   Edwin Lei
• [R] trying to superimpose a line plot onto a histogram   milton ruser
• [R] trying to superimpose a line plot onto a histogram   Edwin Lei
• [R] trying to superimpose a line plot onto a histogram   Edwin Lei
• [R] trying to superimpose a line plot onto a histogram   Edwin Lei
• [R] ts.plot   threshold
• [R] ts.plot   Gabor Grothendieck
• [R] Turn any vector   Zroutik Zroutik
• [R] Turn any vector   Henrique Dallazuanna
• [R] Turn any vector   Gabor Csardi
• [R] Turn any vector   jim holtman
• [R] Turn any vector   jgarcia at ija.csic.es
• [R] Turn any vector   Zroutik Zroutik
• [R] Tutorial on rgl Graphics   Tom La Bone
• [R] Tutorial on rgl Graphics   Duncan Murdoch
• [R] Tutorial on rgl Graphics   Tom La Bone
• [R] Tutorial on rgl Graphics   Duncan Murdoch
• [R] Tutorial on rgl Graphics   Tom La Bone
• [R] Tutorial on rgl Graphics   Duncan Murdoch
• [R] ubuntu and rgl package vs suse ?? static plots   H. Paul Benton
• [R] ubuntu and rgl package vs suse ?? static plots   Duncan Murdoch
• [R] ubuntu and rgl package vs suse ?? static plots   H. Paul Benton
• [R] unable to load a library   Gérard Henry
• [R] Unexpected line type in lattice plot key on pdf device   G. Draisma
• [R] Unexpected line type in lattice plot key on pdf device   Deepayan Sarkar
• [R] update search path for attached data   Ulrich Leopold
• [R] update search path for attached data   Prof Brian Ripley
• [R] update search path for attached data   Ulrich Leopold
• [R] upgrade to 2.5   Sundar Dorai-Raj
• [R] upgrade to 2.5   Gabor Grothendieck
• [R] Urgent   Yunlei.Hu at barclayscapital.com
• [R] Urgent   Moshe Olshansky
• [R] Usage of rJava (.jcall) with Weka functions, any example?   Josep Maria Campanera Alsina
• [R] Usage of rJava (.jcall) with Weka functions, any example?   Dumblauskas, Jerry
• [R] use variable value as vector name   Qian R
• [R] use variable value as vector name   Erik Iverson
• [R] Using if, else statements   Robin Williams
• [R] Using if, else statements   jim holtman
• [R] Using if, else statements   jim holtman
• [R] Using if, else statements   jim holtman
• [R] Using if, else statements   Patrick Burns
• [R] Using if, else statements   milton ruser
• [R] Using if, else statements   milton ruser
• [R] Using if, else statements   Gabriela Cendoya
• [R] Using integrate   Ayman Oweida
• [R] Using integrate   Duncan Murdoch
• [R] Using Internals via their compiled sources   rnoob
• [R] Using ODBC/RODBC with DBI   Prof Brian Ripley
• [R] Using PrettyR to produce LaTeX output   jcarmichael
• [R] Using PrettyR to produce LaTeX output   jcarmichael
• [R] Using PrettyR to produce LaTeX output   Austin, Matt
• [R] Using PrettyR to produce LaTeX output   Gabor Grothendieck
• [R] Using PrettyR to produce LaTeX output   Jim Lemon
• [R] Using PrettyR to produce LaTeX output   jcarmichael
• [R] Using PrettyR to produce LaTeX output   jcarmichael
• [R] Using RODBC to use SQL queries   Albin Blaschka
• [R] Using RODBC to use SQL queries   Prof Brian Ripley
• [R] Using RODBC to use SQL queries   Megan J Bellamy
• [R] Using stop ( ) from a Text Editor   Paulo Cardoso
• [R] Using stop ( ) from a Text Editor   jim holtman
• [R] Using stop ( ) from a Text Editor   Prof Brian Ripley
• [R] Using stop ( ) from a Text Editor   Paulo Cardoso
• [R] using texmacs as front for R on windows xp sp2...   Brian Lunergan
• [R] using which to identify a range of values   sj
• [R] using which to identify a range of values   Henrique Dallazuanna
• [R] using which to identify a range of values   Sebastian P. Luque
• [R] using which to identify a range of values   Julian Burgos
• [R] variable as part of file name   Laura Poggio
• [R] variable as part of file name   Henrique Dallazuanna
• [R] variable as part of file name   Richard Pearson
• [R] variable as part of file name   Laura Poggio
• [R] variable as part of file name   Hans-Jörg Bibiko
• [R] Variable name in a String   R_Learner
• [R] Variable name in a String   Erik Iverson
• [R] vector help   Rajasekaramya
• [R] vector help   Jorge Ivan Velez
• [R] vector help   Henrique Dallazuanna
• [R] vector help   Dimitris Rizopoulos
• [R] version problems of rkward in ubuntu hardy repository   Rainer M Krug
• [R] version problems of rkward in ubuntu hardy repository   Vincent Goulet
• [R] version problems of rkward in ubuntu hardy repository   Rainer M Krug
• [R] vertical bpplot   GOUACHE David
• [R] Visualization of multiple alignments   schragas at post.tau.ac.il
• [R] W-E-I-R-D Weird!   Bert Gunter
• [R] W-E-I-R-D Weird!   Rolf Turner
• [R] W-E-I-R-D Weird!   Bert Gunter
• [R] W-E-I-R-D Weird!   Rolf Turner
• [R] W-E-I-R-D Weird!   Jim Lemon
• [R] W-E-I-R-D Weird!   Thomas Adams
• [R] W-E-I-R-D Weird!   Thomas Adams
• [R] Warning message in if else statement   Monica Pisica
• [R] Warning message in if else statement   Erik Iverson
• [R] Warning message in if else statement   Monica Pisica
• [R] Warning message in if else statement   Monica Pisica
• [R] Weighted variance function?   Arun Kumar Saha
• [R] Weighted variance function?   Gavin Simpson
• [R] Weighted variance function?   Arun Kumar Saha
• [R] Weighted variance function?   Arun Kumar Saha
• [R] Weighted variance function?   Arun Kumar Saha
• [R] what can we do when R gives no response   Peng Jiang
• [R] what can we do when R gives no response   jim holtman
• [R] what can we do when R gives no response   Peng Jiang
• [R] what can we do when R gives no response   jim holtman
• [R] what can we do when R gives no response   Carl Witthoft
• [R] what does this warning mean ?   Peng Jiang
• [R] What is my replication unit? Lmer for binary longitudinal data with blocks and two treaments.   hadley wickham
• [R] What is my replication unit? Lmer for binary longitudinal data with blocks and two treaments.   hpdutra
• [R] What is wrong with this contrast matrix?   Christoph Scherber
• [R] What is wrong with this contrast matrix?   (Ted Harding)
• [R] What is wrong with this contrast matrix?   Christoph Scherber
• [R] What package to use to create a GUI   Judith Flores
• [R] What package to use to create a GUI   Bert Gunter
• [R] What's the best way to operate R from within Excel?   losemind
• [R] What's the best way to operate R from within Excel?   Patrizio Frederic
• [R] What's the best way to operate R from within Excel?   losemind
• [R] What's the T-Value in fisher.test   DaveFrisch
• [R] What's the T-Value in fisher.test   Peter Dalgaard
• [R] What's the T-Value in fisher.test   ctu at bigred.unl.edu
• [R] What's the T-Value in fisher.test   (Ted Harding)
• [R] Which distribution best fits the data?   Matthieu Stigler
• [R] While loop   Rheannon
• [R] While loop   Henrique Dallazuanna
• [R] WIERD: Basic computing in R   poolloopus at yahoo.com
• [R] WIERD: Basic computing in R   Dirk Eddelbuettel
• [R] WIERD: Basic computing in R   Mark Lyman
• [R] WIERD: Basic computing in R   Marc Schwartz
• [R] WIERD: Basic computing in R   Thomas Lumley
• [R] Windows Only: winMenuAdd() problem   Bert Gunter
• [R] Windows Only: winMenuAdd() problem   Duncan Murdoch
• [R] with lapply() how can you retrieve the name of the object   Andrew Yee
• [R] with lapply() how can you retrieve the name of the object   Jorge Ivan Velez
• [R] with lapply() how can you retrieve the name of the object   jim holtman
• [R] with lapply() how can you retrieve the name of the object   jim holtman
• [R] with lapply() how can you retrieve the name of the object   Jorge Ivan Velez
• [R] with lapply() how can you retrieve the name of the object   Andrew Yee
• [R] workspace platform potabillity   Benjamin Otto
• [R] Write lower half of distance matrix only   pgseye
• [R] Write lower half of distance matrix only   jim holtman
• [R] Write lower half of distance matrix only   pgseye
• [R] Write lower half of distance matrix only   jim holtman
• [R] Write lower half of distance matrix only   pgseye
• [R] Write lower half of distance matrix only   Martin Maechler
• [R] writing the plots   Rajasekaramya
• [R] writing the plots   stephen sefick
• [R] writing the plots   John Kane
• [R] wroung groupedData despite reading Bates and Pinheiro 3 times   milton ruser
• [R] wroung groupedData despite reading Bates and Pinheiro 3 times   hpdutra
• [R] wroung groupedData despite reading Bates and Pinheiro 3 times   hpdutra
• [R] xYplot customizing y-axis scaling   Henning Wildhagen
• [R] xYplot customizing y-axis scaling   Christoph Meyer
• [R] xYplot customizing y-axis scaling   Ben Bolker
• [R] xYplot customizing y-axis scaling   Ben Bolker
• [R] xyplot help   ae2356 at hotmail.com
• [R] xyplot help   Felix Andrews
• [R] xyplot: distance between axis and axis-label gets wrong   Sebastian Weber
• [R] y-axis number format on plot, barplot etc.   Bill Cunliffe
• [R] y-axis number format on plot, barplot etc.   Henrique Dallazuanna
• [R] zoo and cex   stephen sefick
• [R] zoo and cex   Marc Schwartz
• [R] Zoo plotting behavior   stephen sefick
• [R] Zoo plotting behavior   stephen sefick
• [R] Zoo plotting behavior   stephen sefick
• [R] Zoo plotting behavior   Gabor Grothendieck
• [R] Zoo plotting behavior   stephen sefick
• [R] Zoo plotting behavior   Gabor Grothendieck
• [R] Zoo plotting behavior   Gabor Grothendieck
• [R] Zoo plotting behavior   stephen sefick
• [R] Zoo plotting behavior   Gabor Grothendieck
• [R] Zoo plotting behavior   Gabor Grothendieck
• [R] {spam?} Re: Error: cannot use PQL when using lmer   Martin Henry H. Stevens
• [R] ~ . help   renata.camargo05 at ntlworld.com
• [R] ~ . help   Michael Dewey
• [R] “Check” problem   leeznar
• [R] “Check” problem   Peter Dalgaard
• [R] 回复: cch() and coxph() for case-cohort   Jin Wang