July 2008 Archives by date
Starting: Tue Jul 1 00:45:40 CEST 2008
Ending: Thu Jul 31 23:47:46 CEST 2008
Messages: 3282
- [R] Re ad Table
jim holtman
- [R] Coda not providing summary on mcmc object
Ben Bolker
- [R] Help in using PCR
Jason Lee
- [R] Mclust ???
Peng Jiang
- [R] PCA : Error in eigen(cv,
Tanya Yatsunenko
- [R] Messge ``no visible binding''.
Rolf Turner
- [R] PCA : Error in eigen(cv,
Daniel Malter
- [R] Help in using PCR
Gavin Simpson
- [R] extracting elements from a list in vectorized form
jgarcia at ija.csic.es
- [R] extracting elements from a list in vectorized form
Peter Dalgaard
- [R] extracting elements from a list in vectorized form
jgarcia at ija.csic.es
- [R] Are centre coordinates or upper left corners used of x, y for SpatialPixels?
Jan.Verbesselt at csiro.au
- [R] Are centre coordinates or upper left corners used of x, y for SpatialPixels?
Paul Hiemstra
- [R] Are centre coordinates or upper left corners used of x, y for SpatialPixels?
Paul Hiemstra
- [R] Help in using PCR
Bjørn-Helge Mevik
- [R] Installing R into home directory?
Steve Cadman
- [R] Help on Analysis of covariance
Partha
- [R] Set default value
Marco Salvi
- [R] reshape matrices
Francisco Javier Santos Alamillos
- [R] reshape matrices
Francisco Javier Santos Alamillos
- [R] reshape matrices
jim holtman
- [R] dev.off() inside a function & other glitches
Michael Hopkins
- [R] Help on Analysis of covariance
Chuck Cleland
- [R] Which distribution best fits the data?
Matthieu Stigler
- [R] Set default value
Michela Cameletti
- [R] Add comments on plot window
Jim Lemon
- [R] Odp: newbie needs help plotting time series
Petr PIKAL
- [R] Add comments on plot window
mysimbaa
- [R] Add comments on plot window
Gabor Grothendieck
- [R] if one of 4 conditions is not satisfied
mysimbaa
- [R] Regression and fitting
Gunther Höning
- [R] trivial list question
Boks, M.P.M.
- [R] lm and NA
Kenn Konstabel
- [R] cohort sampling
Terry Therneau
- [R] Regression and fitting
ONKELINX, Thierry
- [R] adtest for weibull distribution
René Pineda
- [R] trivial list question
Gabor Csardi
- [R] A regression problem using dummy variables
rlearner309
- [R] Find classes of each column of data.frame()
Dong-hyun Oh
- [R] Find classes of each column of data.frame()
Henrique Dallazuanna
- [R] trivial list question
ONKELINX, Thierry
- [R] trivial list question
Henrique Dallazuanna
- [R] Find classes of each column of data.frame()
Gabor Csardi
- [R] Find classes of each column of data.frame()
Dong-hyun Oh
- [R] Find classes of each column of data.frame()
Dong-hyun Oh
- [R] Find classes of each column of data.frame()
Wacek Kusnierczyk
- [R] trivial list question
Kenn Konstabel
- [R] trivial list question
Wacek Kusnierczyk
- [R] Messge ``no visible binding''.
Gregory Warnes
- [R] Problem reading a CSV
Paulo Barata
- [R] Query on packages for Emerging Patterns
Jason Lee
- [R] Help in using PCR
Jason Lee
- [R] Help in using PCR
Erik Iverson
- [R] select.list() cannot be used non-interactively
Fabio Fanoni
- [R] Plotting Bi-Gamma Distribution
Gundala Viswanath
- [R] Regression and fitting
Gunther Höning
- [R] "Invalid object" error in boxplot
mm745 at st-andrews.ac.uk
- [R] Set default value
Erik Iverson
- [R] Help in using PCR
Gavin Simpson
- [R] reshape matrices
Marc Schwartz
- [R] how to automatically maximize the graph window (under XP) ?
Ptit_Bleu
- [R] PCA : Error in eigen(cv,
Tanya Yatsunenko
- [R] if one of 4 conditions is not satisfied
Marc Schwartz
- [R] ignore warning messages?
Hua Li
- [R] RES: how to automatically maximize the graph window (under XP) ?
Leandro Marino
- [R] Prediction with Bayesian Network?
stephanos
- [R] ignore warning messages?
Henrique Dallazuanna
- [R] if one of 4 conditions is not satisfied
mysimbaa
- [R] Orthogonal polynomials and poly
giovanni parrinello
- [R] Simulate from a GAM model
Mark Lyman
- [R] ignore warning messages?
Jorge Ivan Velez
- [R] "Invalid object" error in boxplot
Erik Iverson
- [R] RES: "Invalid object" error in boxplot
Leandro Marino
- [R] Ignore blank columns when reading a row from a table
naw3 at duke.edu
- [R] Ignore blank columns when reading a row from a table
Erik Iverson
- [R] WIERD: Basic computing in R
poolloopus at yahoo.com
- [R] WIERD: Basic computing in R
Dirk Eddelbuettel
- [R] Ignore blank columns when reading a row from a table
Jorge Ivan Velez
- [R] WIERD: Basic computing in R
Mark Lyman
- [R] Fitting a curve to data
Shirin Safa
- [R] WIERD: Basic computing in R
Marc Schwartz
- [R] Problem reading a CSV
Jim Porzak
- [R] RES: WIERD: Basic computing in R
Leandro Marino
- [R] problem with mpiexec and Rmpi
Erin Hodgess
- [R] Problem with loading library-ks
Mayukh Dass
- [R] plot window
Henrique Dallazuanna
- [R] plot window
Leandro Marino
- [R] Change name of a specific column of a data frame
naw3 at duke.edu
- [R] plot window
Gabor Grothendieck
- [R] Change name of a specific column of a data frame
jim holtman
- [R] Change name of a specific column of a data frame
Philip Twumasi-Ankrah
- [R] RES: plot window
Leandro Marino
- [R] RES: Change name of a specific column of a data frame
Leandro Marino
- [R] Fitting a curve to data
stephen sefick
- [R] Fitting a curve to data
Shirin Safa
- [R] Fitting a curve to data
stephen sefick
- [R] Fitting a curve to data
Carl Witthoft
- [R] plot.zoo labels
ryan.sheftel at malbecpartners.com
- [R] WIERD: Basic computing in R
Thomas Lumley
- [R] Simulate from a GAM model
Gavin Simpson
- [R] W-E-I-R-D Weird!
Bert Gunter
- [R] Graph Order in xyplot
Sam Albers
- [R] W-E-I-R-D Weird!
Rolf Turner
- [R] Fitting a curve to data
stephen sefick
- [R] Graph Order in xyplot
Gabor Grothendieck
- [R] W-E-I-R-D Weird!
Bert Gunter
- [R] Graph Order in xyplot
Deepayan Sarkar
- [R] Fitting a curve to data
Gabor Grothendieck
- [R] Area Under a Curve
stephen sefick
- [R] Graph Order in xyplot
hippie dream
- [R] Area Under a Curve
Rolf Turner
- [R] how to estimate the parameters in a bivariate weibull distribution?
程燕
- [R] Fitting a curve to data
Carl Witthoft
- [R] W-E-I-R-D Weird!
Rolf Turner
- [R] adding a package in Windows
Lana Schaffer
- [R] passing a variable at the command line
Erin Hodgess
- [R] dev.off() inside a function & other glitches
Duncan Murdoch
- [R] problem with mpiexec and Rmpi
Martin Morgan
- [R] dev.off() inside a function & other glitches
Deepayan Sarkar
- [R] dev.off() inside a function & other glitches
jim holtman
- [R] passing a variable at the command line
Sebastian P. Luque
- [R] A regression problem using dummy variables
Moshe Olshansky
- [R] passing a variable at the command line
Marc Schwartz
- [R] passing a variable at the command line
Dirk Eddelbuettel
- [R] adding a package in Windows
Duncan Murdoch
- [R] problem with mpiexec and Rmpi
Dirk Eddelbuettel
- [R] if one of 4 conditions is not satisfied
Peng Jiang
- [R] problem with mpiexec and Rmpi
Dirk Eddelbuettel
- [R] PCA : Error in eigen(cv,
Daniel Malter
- [R] Install Packages in Windows Vista
nicholasw22
- [R] is there an equivalent of prop.table but for counts
markleeds at verizon.net
- [R] forget my previous question
markleeds at verizon.net
- [R] is there an equivalent of prop.table but for counts
Jorge Ivan Velez
- [R] is there an equivalent of prop.table but for counts
Jorge Ivan Velez
- [R] plot.zoo labels
stephen sefick
- [R] Install Packages in Windows Vista
Charles Annis, P.E.
- [R] Survival Analysis questions
Viet Le
- [R] plot.zoo labels
Gabor Grothendieck
- [R] Problems with lm()
Hsin-Ya Lee
- [R] Install Packages in Windows Vista
Gabor Grothendieck
- [R] Fitting a curve to data
Vikas Rawal
- [R] A regression problem using dummy variables
rlearner309
- [R] Area Under a Curve
bartjoosen
- [R] bug in axis.Date? was (Re: newbie needs help plotting time series)
Petr PIKAL
- [R] Problem with loading library-ks
Uwe Ligges
- [R] Help in using PCR
Bjørn-Helge Mevik
- [R] Optimal lag selection in Granger Causality tests
tolga.i.uzuner at jpmorgan.com
- [R] Optimal lag selection in Granger Causality tests
ONKELINX, Thierry
- [R] Optimal lag selection in Granger Causality tests
tolga.i.uzuner at jpmorgan.com
- [R] position legend below x-axis title
Anne-Marie Ternes
- [R] Combining playwith with par(mfrow... ) i.e., multiple plots.
Vorlow Constantinos
- [R] Help in using PCR
Gavin Simpson
- [R] conversion of data for use within barchart
Karin Lagesen
- [R] Sweave / Latex per-chapter output
Anne-Marie Ternes
- [R] Correlation structures in gls with repeated measurements
t03eh7 at abdn.ac.uk
- [R] W-E-I-R-D Weird!
Jim Lemon
- [R] position legend below x-axis title
Gabor Grothendieck
- [R] how do I read only specific columns using read.csv or other read function
Philip James Smith
- [R] how do I read only specific columns using read.csv or other read function
Ben Tupper
- [R] Help in using PCR
Bjørn-Helge Mevik
- [R] W-E-I-R-D Weird!
Thomas Adams
- [R] W-E-I-R-D Weird!
Thomas Adams
- [R] dev.off() inside a function & other glitches
Michael Hopkins
- [R] RES: bug in axis.Date? was (Re: newbie needs help plotting timeseries)
Leandro Marino
- [R] Plotting Bi-Gamma Distribution
Ben Bolker
- [R] Can't install package Matrix on solaris.
Scott Brown
- [R] FW: RES: bug in axis.Date? was (Re: newbie needs help plottingtimeseries)
Kurapati, Ravichandra (Ravichandra)
- [R] Correlation structures in gls with repeated measurements
ONKELINX, Thierry
- [R] Question about GCL function
Peter Flom
- [R] Odp: RES: bug in axis.Date? was (Re: newbie needs help plotting timeseries)
Petr PIKAL
- [R] Correlation structures in gls with repeated measurements
t03eh7 at abdn.ac.uk
- [R] Optimal lag selection in Granger Causality tests
Matthieu Stigler
- [R] Odp: FW: RES: bug in axis.Date? was (Re: newbie needs help plottingtimeseries)
Petr PIKAL
- [R] Zoo plotting behavior
stephen sefick
- [R] survival package test stats
Geoffrey Smith
- [R] variable as part of file name
Laura Poggio
- [R] Zoo plotting behavior
stephen sefick
- [R] A regression problem using dummy variables
rlearner309
- [R] variable as part of file name
Henrique Dallazuanna
- [R] variable as part of file name
Richard Pearson
- [R] randomForest training error
Soumyadeep Nandi
- [R] Plotting Bi-Gamma Distribution
Gundala Viswanath
- [R] variable as part of file name
Laura Poggio
- [R] Zoo plotting behavior
stephen sefick
- [R] Zoo plotting behavior
Gabor Grothendieck
- [R] Migrating from S-Plus to R - Exporting Tables
Leandro Marino
- [R] Zoo plotting behavior
stephen sefick
- [R] variable as part of file name
Hans-Jörg Bibiko
- [R] Problem reading from a data frame
naw3 at duke.edu
- [R] Odp: FW: RES: bug in axis.Date? was (Re: newbie needs help plottingtimeseries)
Kathi
- [R] Usage of rJava (.jcall) with Weka functions, any example?
Josep Maria Campanera Alsina
- [R] Zoo plotting behavior
Gabor Grothendieck
- [R] Problem reading from a data frame
Jorge Ivan Velez
- [R] Insert text in data.frame
Mafalda Viana
- [R] Zoo plotting behavior
Gabor Grothendieck
- [R] Zoo plotting behavior
stephen sefick
- [R] A regression problem using dummy variables
Thomas Lumley
- [R] Tobit Estimation with Panel Data
Arne Henningsen
- [R] Multiple time series plots
Kerpel, John
- [R] Zoo plotting behavior
Gabor Grothendieck
- [R] Zoo plotting behavior
Gabor Grothendieck
- [R] log plots woes
Patrick Jackson
- [R] passing a variable at the command line
Luke Tierney
- [R] help on list comparison
Rajasekaramya
- [R] Optimal lag selection in Granger Causality tests
tolga.i.uzuner at jpmorgan.com
- [R] Problem reading from a data frame
jim holtman
- [R] Hmisc latex function with longtable option
Erik Iverson
- [R] get formatted regression output
Bunny, lautloscrew.com
- [R] Extracting regression coef. and p-values in JRClient
Amine Mohamed ROUANE HACENE
- [R] Extracting regression coef. and p-values in JRClient
Amine Mohamed ROUANE HACENE
- [R] Sunset in Dortmund
Marc Schwartz
- [R] auto.key in xyplot in conjunction with panel.text
David Afshartous
- [R] get formatted regression output
Abhijit Dasgupta
- [R] multiplication question
Murali Menon
- [R] Plotting Bi-Gamma Distribution
Wolfgang Raffelsberger
- [R] Hmisc latex function with longtable option
Frank E Harrell Jr
- [R] Problem reading from a data frame
Marc Schwartz
- [R] error on predict
Michele Santacatterina
- [R] Multiple time series plots
stephen sefick
- [R] plot.zoo labels
ryan.sheftel at malbecpartners.com
- [R] how do I read only specific columns using read.csv or other read function
Charles C. Berry
- [R] question on dispersion parameter
jpl
- [R] Multiple time series plots
Kerpel, John
- [R] Problem with strucchange package
tolga.i.uzuner at jpmorgan.com
- [R] heatmap
Nair, Murlidharan T
- [R] help appreciated to make a plot
Zheng Lu
- [R] Reading CSV file with unequal record length
Viswanathan Shankar
- [R] flow map lines between point pairs (latitude/longitude)
Richard and Barbara Males
- [R] Accessing a field in a data fram
R_Learner
- [R] Goodness of fit test
martin.gaston at unavarra.es
- [R] graph woes
Patrick Jackson
- [R] Multiple time series plots
Gabor Grothendieck
- [R] Sunset in Dortmund
Johannes Huesing
- [R] Problem with strucchange package
Achim Zeileis
- [R] exporting ftable
Leandro Marino
- [R] help appreciated to make a plot
Gabor Grothendieck
- [R] Sunset in Dortmund
Marc Schwartz
- [R] exporting ftable
Henrique Dallazuanna
- [R] heatmap
Nair, Murlidharan T
- [R] NLME questions -- interpretation of results
Jenny Sun
- [R] conversion of data for use within barchart
Deepayan Sarkar
- [R] multiplication question
Peter Alspach
- [R] multiplication question
N. Lapidus
- [R] multiplication question
Henrique Dallazuanna
- [R] multiplication question
Henrique Dallazuanna
- [R] Reading CSV file with unequal record length
Marc Schwartz
- [R] Accessing a field in a data fram
jim holtman
- [R] set values in data.frame to NA conditional on another data.frame
Carson Farmer
- [R] Reading CSV file with unequal record length
Peter Dalgaard
- [R] Accessing a field in a data fram
Marc Schwartz
- [R] multiplication question
Kenn Konstabel
- [R] flow map lines between point pairs (latitude/longitude)
Ray Brownrigg
- [R] Insert text in data.frame
jim holtman
- [R] Removing or overwriting an XML node
Steffen Neumann
- [R] help on list comparison
Jorge Ivan Velez
- [R] flow map lines between point pairs (latitude/longitude)
Richard and Barbara Males
- [R] NLME questions -- interpretation of results
ctu at bigred.unl.edu
- [R] A regression problem using dummy variables
rlearner309
- [R] auto.key in xyplot in conjunction with panel.text
Deepayan Sarkar
- [R] plot.zoo labels
Gabor Grothendieck
- [R] neural networks
Donna Tucker
- [R] Migrating from S-Plus to R - Exporting Tables
jim holtman
- [R] what can we do when R gives no response
Peng Jiang
- [R] Plotting Prediction Surface with persp()
Rory Winston
- [R] How do I paste double quotes arround a character string?
Philip James Smith
- [R] how to capture matching words in a string ?
Daren Tan
- [R] How do I paste double quotes arround a character string?
Erik Iverson
- [R] how to capture matching words in a string ?
Gabor Grothendieck
- [R] problem with lm and predict - no predictions made
Keld Jørn Simonsen
- [R] problem with lm and predict - no predictions made
Erik Iverson
- [R] problem with lm and predict - no predictions made
Jorge Ivan Velez
- [R] what can we do when R gives no response
jim holtman
- [R] lm() question
Ranney, Steven
- [R] NLME questions -- interpretation of results
Jenny Sun
- [R] Processing 10^8 rows and 1^3 columns
Daren Tan
- [R] Otpmial initial centroid in kmeans
Chua Siang Li
- [R] Processing 10^8 rows and 1^3 columns
Gabor Grothendieck
- [R] Plotting Prediction Surface with persp()
Duncan Murdoch
- [R] NLME questions -- interpretation of results
ctu at bigred.unl.edu
- [R] what can we do when R gives no response
Peng Jiang
- [R] randomForest.error: length of response must be the same as predictors
Soumyadeep Nandi
- [R] playwith package does not work on Ubuntu?
Felix Andrews
- [R] Odp: set values in data.frame to NA conditional on another data.frame
Petr PIKAL
- [R] how to automatically maximize the graph window (under XP) ?
Ptit_Bleu
- [R] Plotting Prediction Surface with persp()
rory.winston at gmail.com
- [R] Problem with strucchange package
tolga.i.uzuner at jpmorgan.com
- [R] RODBC Access limit?
HBaize
- [R] post hoc comparisons on NLME for longitudinal data
Humberto Dutra
- [R] (no subject)
Silika Prohl
- [R] problem with lm and predict - no predictions made
Keld Jørn Simonsen
- [R] latex styling for R regression outputs
Matthias Bannert
- [R] A regression problem using dummy variables
Peter Dalgaard
- [R] Migrating from S-Plus to R - Exporting Tables
Gustaf Rydevik
- [R] ggplot2 legend for vertical lines
baptiste Auguié
- [R] Matrix set value problem
Valentino Botta
- [R] How do I paste double quotes arround a character string?
(Ted Harding)
- [R] RODBC Access limit?
ONKELINX, Thierry
- [R] Otpmial initial centroid in kmeans
Gavin Simpson
- [R] Matrix set value problem
ONKELINX, Thierry
- [R] get formatted regression output
Jim Lemon
- [R] multiplication question
Murali Menon
- [R] help appreciated to make a plot
Jim Lemon
- [R] dgamma in WinBUGS and JAGS (rjags)
Seyed Reza Jafarzadeh
- [R] randomForest.error: length of response must be the same as predictors
Gavin Simpson
- [R] as.Date() clarification
Ron Michael
- [R] PCA on image data
Bio7
- [R] How do I paste double quotes arround a character string?
Philip James Smith
- [R] A regression problem using dummy variables
Ron Michael
- [R] Problem in applying conditional looping
Nadeem Shafique
- [R] as.Date() clarification
Achim Zeileis
- [R] Matrix set value problem
ctu at bigred.unl.edu
- [R] latex styling for R regression outputs
Paul Hiemstra
- [R] as.Date() clarification
Peter Dalgaard
- [R] How do I paste double quotes arround a character string?
(Ted Harding)
- [R] How do I paste double quotes arround a character string?
Philip James Smith
- [R] correction to small typo: How do I paste double quotes arround a character string?
Philip James Smith
- [R] Using ODBC/RODBC with DBI
Prof Brian Ripley
- [R] Lattice: reasons for not passing subscripted "col", "pch", "lty", "fill" to panel functions
Vitalie Spinu
- [R] Installation 2.7.1 [requires Perl >= 5.8.0]
Prof Brian Ripley
- [R] randomForest.error: length of response must be the same as predictors
Soumyadeep Nandi
- [R] How do I paste double quotes arround a character string?
Prof Brian Ripley
- [R] Akaike or BIC criteria for feed-forward neural nets
Prof Brian Ripley
- [R] Data size
arghya ganguli
- [R] select.list() cannot be used non-interactively
Prof Brian Ripley
- [R] survival package test stats
Terry Therneau
- [R] Problem in applying conditional looping
jim holtman
- [R] Orthogonal polynomials and poly
Prof Brian Ripley
- [R] Problem with loading library-ks
Prof Brian Ripley
- [R] what can we do when R gives no response
jim holtman
- [R] loop calculation
Ben Bolker
- [R] PCA on image data
Jorge Ivan Velez
- [R] Can't install package Matrix on solaris.
Prof Brian Ripley
- [R] Tobit Estimation with Panel Data
Terry Therneau
- [R] problem with lm and predict - no predictions made
Petr PIKAL
- [R] Prediction with Bayesian Network?
Marco Scutari
- [R] *** significance with xtable
Bunny, lautloscrew.com
- [R] PCA on image data
Bio7
- [R] how to automatically maximize the graph window (under XP) ?
Prof Brian Ripley
- [R] How do I paste double quotes arround a character string?
(Ted Harding)
- [R] PCA on image data
Jorge Ivan Velez
- [R] How do I paste double quotes arround a character string?
Prof Brian Ripley
- [R] combining time series [was: (no subject)]
Gabor Grothendieck
- [R] combining time series [was: (no subject)]
Gabor Grothendieck
- [R] How do I paste double quotes arround a character string?
Philip James Smith
- [R] How to emulate perl style of reading files ?
Daren Tan
- [R] ggplot2: scaling and tick mark of x-axis
Henning Wildhagen
- [R] ggplot2 legend for vertical lines
hadley wickham
- [R] PCA on image data
Bio7
- [R] auto.key in xyplot in conjunction with panel.text
David Afshartous
- [R] PCA on image data
Monica Pisica
- [R] cross-validation in rpart
Sam Stewart
- [R] Data size
John Kane
- [R] How to emulate perl style of reading files ?
Duncan Murdoch
- [R] Usage of rJava (.jcall) with Weka functions, any example?
Dumblauskas, Jerry
- [R] A regression problem using dummy variables
Bert Gunter
- [R] Sunset in Dortmund
John Kane
- [R] ggplot2: scaling and tick mark of x-axis
hadley wickham
- [R] read.table, NA assignment, and sep
Juliet Hannah
- [R] How to emulate perl style of reading files ?
Prof Brian Ripley
- [R] A regression problem using dummy variables
rlearner309
- [R] Thanks!
R_Learner
- [R] read.table, NA assignment, and sep
Peter Dalgaard
- [R] Reproducibility and GUIs
roger koenker
- [R] Fitting a curve to data
Greg Snow
- [R] Sunset in Dortmund
Marc Schwartz
- [R] position legend below x-axis title
Greg Snow
- [R] Thanks!
Marc Schwartz
- [R] Sunset in Dortmund
Uwe Ligges
- [R] Lattice: reasons for not passing subscripted "col", "pch", "lty", "fill" to panel functions
Deepayan Sarkar
- [R] Biostatistician Positions at Vanderbilt University
Frank E Harrell Jr
- [R] graph woes
Patrick Jackson
- [R] Random effects and lme4
wmh
- [R] For loop
laila khalfan
- [R] R-help Digest, Vol 65, Issue 4
José Ignacio Bustos Melo
- [R] R-help Digest, Vol 65, Issue 4
José Ignacio Bustos Melo
- [R] Relative Mortality Risk second part
José Ignacio Bustos Melo
- [R] Re membering the last time an event occurred within a dataframe
Jim Price
- [R] graph woes
Gabor Grothendieck
- [R] Re membering the last time an event occurred within a dataframe
Gabor Grothendieck
- [R] Re membering the last time an event occurred within a dataframe
Henrique Dallazuanna
- [R] Re membering the last time an event occurred within a dataframe
Jim Price
- [R] Re membering the last time an event occurred within a dataframe
Duncan Murdoch
- [R] *** significance with xtable
Marc Schwartz
- [R] Recoding a variable
Spencer
- [R] Sunset in Dortmund
Johannes Huesing
- [R] problem with lm and predict - no predictions made
Keld Jørn Simonsen
- [R] Relative Mortality Risk second part
Marc Schwartz
- [R] Recoding a variable
jim holtman
- [R] Recoding a variable
Stephan Kolassa
- [R] FW: For loop
laila khalfan
- [R] Recoding a variable
John Fox
- [R] Thanks!
R_Learner
- [R] Exporting a Graph that has lines()
R_Learner
- [R] Recoding a variable
Peter Dalgaard
- [R] as.Date() clarification
Martin Maechler
- [R] Installation of packages via GUI, Mac OS X
David Afshartous
- [R] lines() warning message
Ranney, Steven
- [R] Can't install package Matrix on solaris.
Martin Maechler
- [R] L1 nonlinear approximation
Tine Mlac
- [R] Exporting a Graph that has lines()
Peter Dalgaard
- [R] lines() warning message
Peter Dalgaard
- [R] Installation of packages via GUI, Mac OS X
Don MacQueen
- [R] First attempt to use R
Ted
- [R] what can we do when R gives no response
Carl Witthoft
- [R] subset function within a function
Lana Schaffer
- [R] Removing or overwriting an XML subtree
Steffen Neumann
- [R] subset function within a function
Henrique Dallazuanna
- [R] For loop
laila khalfan
- [R] apply with a division
Greg Kettler
- [R] First attempt to use R
Roland Rau
- [R] lines() warning message
Ranney, Steven
- [R] L1 nonlinear approximation
roger koenker
- [R] apply with a division
Henrique Dallazuanna
- [R] lines() warning message
Peter Dalgaard
- [R] Exporting a Graph that has lines()
R_Learner
- [R] 'as.Date' conversion of classes POSIX*t (problem/feature)?
Angel Spassov
- [R] Ternaryplot function
theBenjamin
- [R] First attempt to use R
Gabor Grothendieck
- [R] Installing R into home directory?
p_connolly at slingshot.co.nz
- [R] Ternaryplot function
Rolf Turner
- [R] 'as.Date' conversion of classes POSIX*t (problem/feature)?
Gabor Grothendieck
- [R] apply with a division
Marc Schwartz
- [R] Tobit Estimation with Panel Data
Arne Henningsen
- [R] apply with a division
Gabor Grothendieck
- [R] apply with a division
Abhijit Dasgupta
- [R] A regression problem using dummy variables
Ron Michael
- [R] by or tapply?
Michael Denslow
- [R] by or tapply?
jim holtman
- [R] problem with NA and if
Keld Jørn Simonsen
- [R] Recoding
Agustin Lobo
- [R] problem with NA and if
Andrew Robinson
- [R] problem with NA and if
Albert Greinoecker
- [R] problem with NA and if
Bill.Venables at csiro.au
- [R] kriging problem(?)
robert.ptacnik at niva.no
- [R] Problem in installing Biobase
Jason Lee
- [R] apply with a division
Gavin Simpson
- [R] Problem in installing Biobase
Prof Brian Ripley
- [R] kriging problem(?)
Paul Hiemstra
- [R] Exporting a Graph that has lines()
Peter Dalgaard
- [R] Hmisc latex: table column width
Lauri Nikkinen
- [R] passing arguments to a R script
Daren Tan
- [R] stop without error message
Eric Ferreira
- [R] problem with NA and if
Keld J?rn Simonsen
- [R] Problem with strucchange package
tolga.i.uzuner at jpmorgan.com
- [R] stop without error message
Duncan Murdoch
- [R] test for difference in variance
Anders Malmendal
- [R] Repeated measures lme or anova
John Coulthard
- [R] Test for multiple comparisons: Nonlinear model, autocorrelation?
J S
- [R] initialize a matrix
mysimbaa
- [R] initialize a matrix
mysimbaa
- [R] update search path for attached data
Ulrich Leopold
- [R] initialize a matrix
mysimbaa
- [R] initialize a matrix
mysimbaa
- [R] update search path for attached data
Prof Brian Ripley
- [R] initialize a matrix
mysimbaa
- [R] initialize a matrix
mysimbaa
- [R] initialize a matrix
mysimbaa
- [R] Re ad in a file - produce independent vectors
jimineep
- [R] Re ad in a file - produce independent vectors
Gabor Grothendieck
- [R] Odp: Re ad in a file - produce independent vectors
Petr PIKAL
- [R] Calling and running a compiled program inside R
Paek, Insu
- [R] Re ad in a file - produce independent vectors
Marc Schwartz
- [R] Re ad in a file - produce independent vectors
Prof Brian Ripley
- [R] create a zero matrix & fill
mysimbaa
- [R] create a zero matrix & fill
mysimbaa
- [R] RES: initialize a matrix
Leandro Marino
- [R] RES: Error while plotting matrix
Leandro Marino
- [R] create a zero matrix & fill
jim holtman
- [R] Calling and running a compiled program inside R
jim holtman
- [R] logistic regreesion and score test
刘杰
- [R] logistic regreesion and score test
Frank E Harrell Jr
- [R] set type of SS in anova()
jeroenooms
- [R] synthax for R CMD INSTALL
Naiara Pinto
- [R] Test for multiple comparisons: Nonlinear model, autocorrelation?
Spencer Graves
- [R] p-value for Nonmetric Multidimentional Scaling?
Michael Denslow
- [R] p-value for Nonmetric Multidimentional Scaling?
Bill.Venables at csiro.au
- [R] set type of SS in anova()
Prof Brian Ripley
- [R] synthax for R CMD INSTALL
Prof Brian Ripley
- [R] trying to superimpose a line plot onto a histogram
Edwin Lei
- [R] lattice smooth
Troels Ring
- [R] Bland-Altman method to measure agreement with repeated measures
kende jan
- [R] update search path for attached data
Ulrich Leopold
- [R] p-value for Nonmetric Multidimentional Scaling?
Gavin Simpson
- [R] set type of SS in anova()
John Fox
- [R] Test for multiple comparisons: Nonlinear model, autocorrelation?
J S
- [R] trying to superimpose a line plot onto a histogram
milton ruser
- [R] help about random generation of a Normal distribution of several variables
Arnau Mir Torres
- [R] help about random generation of a Normal distribution of several variables
Arnau Mir
- [R] help about random generation of a Normal distribution of several variables
Peng Jiang
- [R] Bland-Altman method to measure agreement with repeated measures
Marc Schwartz
- [R] help about random generation of a Normal distribution of several variables
Gavin Simpson
- [R] help about random generation of a Normal distribution of
(Ted Harding)
- [R] SciViews GUI
Felipe Carrillo
- [R] Random Forest %var(y)
David Katz
- [R] SciViews GUI
Philippe Grosjean
- [R] trying to superimpose a line plot onto a histogram
Edwin Lei
- [R] using texmacs as front for R on windows xp sp2...
Brian Lunergan
- [R] extracting values from a "by" function
Daniel Stahl
- [R] Problem solved: extracting values from a "by" function
Daniel Stahl
- [R] interpreting mixed model anova results
Brooke LaFlamme
- [R] Error: cannot use PQL when using lmer
hpdutra at yahoo.com
- [R] Error: cannot use PQL when using lmer
Ben Bolker
- [R] Error: cannot use PQL when using lmer
hpdutra at yahoo.com
- [R] help about random generation of a Normal distribution of several variables
Peng Jiang
- [R] trying to superimpose a line plot onto a histogram
Edwin Lei
- [R] Different Autocorrelation using R and other softwares
Yinny
- [R] help about random generation of a Normal distribution ofseveral variables
Bill.Venables at csiro.au
- [R] help about random generation of a Normal distribution ofseveral variables
Bill.Venables at csiro.au
- [R] lattice question
markleeds at verizon.net
- [R] trying to superimpose a line plot onto a histogram
Edwin Lei
- [R] interpreting mixed model anova results
hpdutra
- [R] Error: cannot use PQL when using lmer
hpdutra
- [R] Different Autocorrelation using R and other softwares
Prof Brian Ripley
- [R] looking for alternative of 'if-else'
Arun Kumar Saha
- [R] lattice question
Felix Andrews
- [R] looking for alternative of 'if-else'
Duncan Murdoch
- [R] looking for alternative of 'if-else'
ctu at bigred.unl.edu
- [R] help about random generation of a Normal distribution of
(Ted Harding)
- [R] "lwd" gives different plotted line widths for Vertical and horizontal Lines when lwd= 2?
Pedro de Barros
- [R] lattice smooth problem?
Troels Ring
- [R] lattice smooth problem?
Gavin Simpson
- [R] {spam?} Re: Error: cannot use PQL when using lmer
Martin Henry H. Stevens
- [R] Repeated measures lme or anova
Martin Henry H. Stevens
- [R] Interpreting messages when building packages
Johannes Huesing
- [R] Interpreting messages when building packages
Duncan Murdoch
- [R] "lwd" gives different plotted line widths for Vertical and horizontal Lines when lwd= 2?
hadley wickham
- [R] Repeated measures lme or anova
hadley wickham
- [R] Backgrounds in Multiple Plots made with "fig"
Tom La Bone
- [R] Windows Only: winMenuAdd() problem
Bert Gunter
- [R] "lwd" gives different plotted line widths for Vertical and horizontal Lines when lwd= 2?
Pedro de Barros
- [R] Ignore blank columns when reading a row from a table
Bernardo Rangel Tura
- [R] Windows Only: winMenuAdd() problem
Duncan Murdoch
- [R] Test for multiple comparisons: Nonlinear model, autocorrelation?
Spencer Graves
- [R] Lots of huge matrices, for-loops, speed
Zarza
- [R] looking for alternative of 'if-else'
Arun Kumar Saha
- [R] Hi~problem with the two sample test: ks2Test in the package of fbasics
lily
- [R] looking for alternative of 'if-else'
Duncan Murdoch
- [R] What is my replication unit? Lmer for binary longitudinal data with blocks and two treaments.
hpdutra
- [R] Error in defining function
Megh Dal
- [R] looking for alternative of 'if-else'
ctu at bigred.unl.edu
- [R] ts.plot
threshold
- [R] Error in defining function
Gabor Grothendieck
- [R] Lots of huge matrices, for-loops, speed
jim holtman
- [R] Benchmarking R and R Workloads
Imanpreet
- [R] Lots of huge matrices, for-loops, speed
Ray Brownrigg
- [R] ts.plot
Gabor Grothendieck
- [R] Regular expressions: bug or misunderstanding?
Duncan Murdoch
- [R] Regular expressions: bug or misunderstanding?
Gabor Grothendieck
- [R] Regular expressions: bug or misunderstanding?
(Ted Harding)
- [R] Issue with postscript figures using WinAnsi encoding
Michael Rennie
- [R] Issue with postscript figures using WinAnsi encoding
Michael Rennie
- [R] Numbers as Points in Graphs
hippie dream
- [R] What is my replication unit? Lmer for binary longitudinal data with blocks and two treaments.
hadley wickham
- [R] Numbers as Points in Graphs
milton ruser
- [R] Numbers as Points in Graphs
hippie dream
- [R] Numbers as Points in Graphs
markleeds at verizon.net
- [R] Lots of huge matrices, for-loops, speed
Moshe Olshansky
- [R] Numbers as Points in Graphs
milton ruser
- [R] Numbers as Points in Graphs
(Ted Harding)
- [R] ignore warning messages?
Hua Li
- [R] Regular expressions: bug or misunderstanding?
Duncan Murdoch
- [R] Numbers as Points in Graphs
hippie dream
- [R] color with tcl/tk?
Hua Li
- [R] Exception Handling
Tudor Bodea
- [R] Regular expressions: bug or misunderstanding?
Gabor Grothendieck
- [R] Lots of huge matrices, for-loops, speed
Rolf Turner
- [R] Numbers as Points in Graphs
markleeds at verizon.net
- [R] Method for checking automatically which distribtions fits a data
Gundala Viswanath
- [R] Regular expressions: bug or misunderstanding?
Duncan Murdoch
- [R] Lots of huge matrices, for-loops, speed
Moshe Olshansky
- [R] How can i do an automatic upgrade of R 2.5.1 to R 2.7.1
Jason Lee
- [R] How can i do an automatic upgrade of R 2.5.1 to R 2.7.1
Jason Lee
- [R] Method for checking automatically which distribtions fits a data
ctu at bigred.unl.edu
- [R] Error in defining function
Megh Dal
- [R] [R-pkgs] Functional Data Analysis, fda_1.2.4
Spencer Graves
- [R] How can i do an automatic upgrade of R 2.5.1 to R 2.7.1
Dirk Eddelbuettel
- [R] Error in defining function
Gabor Grothendieck
- [R] Backgrounds in Multiple Plots made with "fig"
Paul Murrell
- [R] Plot Mixtures of Synthetically Generated Gamma Distributions
Gundala Viswanath
- [R] Plot Mixtures of Synthetically Generated Gamma Distributions
Jorge Ivan Velez
- [R] Plot Mixtures of Synthetically Generated Gamma Distributions
Jorge Ivan Velez
- [R] Hi~problem with the two sample test: ks2Test in the package of fbasics
l y
- [R] Plot Mixtures of Synthetically Generated Gamma Distributions
Moshe Olshansky
- [R] Plot Mixtures of Synthetically Generated Gamma Distributions
Stephen Tucker
- [R] Method for checking automatically which distribtions fits a data
Stephen Tucker
- [R] How can i do an automatic upgrade of R 2.5.1 to R 2.7.1
Paul Hiemstra
- [R] Error in defining function
Megh Dal
- [R] How can i do an automatic upgrade of R 2.5.1 to R 2.7.1
Paul Hiemstra
- [R] GLM, LMER, GEE interpretation
Daniel Malter
- [R] How can i do an automatic upgrade of R 2.5.1 to R 2.7.1
Paul Hiemstra
- [R] Hmisc latex: table column width
Lauri Nikkinen
- [R] Change language in Rcmdr
Schleuh
- [R] How can i do an automatic upgrade of R 2.5.1 to R 2.7.1
Thibaut Jombart
- [R] one-site competition data // curve fitting
Thiemo Schreiber
- [R] How can I optimize this piece of code ?
Daren Tan
- [R] indicating significant differences in boxplots
Sebastian Merz
- [R] spatial statistics and matrix algebra
Paulo Cardoso
- [R] How can I optimize this piece of code ?
ONKELINX, Thierry
- [R] Howto Initialize Parameter of Gamma Mixture Densities for EM
Gundala Viswanath
- [R] RES: Need ideas on how to show spikes in my data and how to codeit in R
Thomas Frööjd
- [R] Change language in Rcmdr
Duncan Murdoch
- [R] Error in defining function
Gabor Grothendieck
- [R] Change language in Rcmdr
Philippe Grosjean
- [R] indicating significant differences in boxplots
Jim Lemon
- [R] Sorting a list
tolga.i.uzuner at jpmorgan.com
- [R] Exception Handling
jim holtman
- [R] Bland-Altman method to measure agreement with repeated measures
Nutter, Benjamin
- [R] Sorting a list
Peter Dalgaard
- [R] Sorting a list
milton ruser
- [R] cross-validation in rpart
Terry Therneau
- [R] Change language in Rcmdr
John Fox
- [R] A quick question about lm()
rlearner309
- [R] Method for checking automatically which distribtions fits a data
Ben Bolker
- [R] Test for multiple comparisons: Nonlinear model, autocorrelation?
J S
- [R] Hi~problem with the two sample test: ks2Test in the package of fbasics
Ben Bolker
- [R] A quick question about lm()
Henrique Dallazuanna
- [R] A quick question about lm()
(Ted Harding)
- [R] A quick question about lm()
Tobias Verbeke
- [R] A quick question about lm()
ONKELINX, Thierry
- [R] A quick question about lm()
(Ted Harding)
- [R] Plot depends on conditions
mysimbaa
- [R] Method for checking automatically which distribtions fits a data
hadley wickham
- [R] Running "all possible subsets" of a GLM (binomial) model
Eric Vander Wal
- [R] Exception Handling
Paul Gilbert
- [R] Drawing a colour wheel - bug in hcl?
hadley wickham
- [R] "lwd" gives different plotted line widths for Vertical and horizontal Lines when lwd= 2?
hadley wickham
- [R] L1 nonlinear approximation
Greg Snow
- [R] Method for checking automatically which distribtions fits a data
David Reinke
- [R] Plot depends on conditions
jim holtman
- [R] Method for checking automatically which distribtions fits a data
Frank E Harrell Jr
- [R] Running "all possible subsets" of a GLM (binomial) model
hadley wickham
- [R] Running "all possible subsets" of a GLM (binomial) model
Ben Bolker
- [R] Relative Mortality Risk second part
Terry Therneau
- [R] GLM, LMER, GEE interpretation
Ben Bolker
- [R] Colour clusters in a 2d plot
Josep Maria Campanera Alsina
- [R] A shorter version of ".Last.value"?
Jon Zadra
- [R] Drawing a colour wheel - bug in hcl?
Earl F. Glynn
- [R] A shorter version of ".Last.value"?
Gabor Grothendieck
- [R] A shorter version of ".Last.value"?
Peter Dalgaard
- [R] A shorter version of ".Last.value"?
Peter Dalgaard
- [R] Colour clusters in a 2d plot
Jorge Ivan Velez
- [R] GLM, LMER, GEE interpretation
ctu at bigred.unl.edu
- [R] Interest in a Use R Group in San Francisco area?
Jim Porzak
- [R] Interest in a Use R Group in San Francisco area?
Marc Schwartz
- [R] Interpreting messages when building packages
Johannes Huesing
- [R] subset() multiple arguments
stephen sefick
- [R] Interpreting messages when building packages
Duncan Murdoch
- [R] subset() multiple arguments
Henrique Dallazuanna
- [R] subset() multiple arguments
Duncan Murdoch
- [R] Interest in a Use R Group in San Francisco area?
Peter Dalgaard
- [R] subset() multiple arguments
Peter Dalgaard
- [R] Interpreting messages when building packages
Johannes Huesing
- [R] Drawing a colour wheel - bug in hcl?
hadley wickham
- [R] Colour clusters in a 2d plot
hadley wickham
- [R] Interest in a Use R Group in San Francisco area?
Marc Schwartz
- [R] Interpreting messages when building packages
Duncan Murdoch
- [R] Interpreting messages when building packages
Johannes Huesing
- [R] indicating significant differences in boxplots
John Kane
- [R] Basic Vector and Matrix Operations
Eric Turkheimer
- [R] Basic Vector and Matrix Operations
Xiaohui Chen
- [R] Basic Vector and Matrix Operations
apjaworski at mmm.com
- [R] Basic Vector and Matrix Operations
Jorge Ivan Velez
- [R] GLM, LMER, GEE interpretation
Daniel Malter
- [R] Basic Vector and Matrix Operations
Erik Iverson
- [R] Drawing a colour wheel - bug in hcl?
Earl F. Glynn
- [R] Drawing a colour wheel - bug in hcl?
Achim Zeileis
- [R] Interest in a Use R Group in San Francisco area?
Peter Dalgaard
- [R] Drawing a colour wheel - bug in hcl?
hadley wickham
- [R] GLM, LMER, GEE interpretation
Ben Bolker
- [R] Drawing a colour wheel - bug in hcl?
hadley wickham
- [R] Drawing a colour wheel - bug in hcl?
Achim Zeileis
- [R] Survey questions
Farley, Robert
- [R] multiplication question
Moshe Olshansky
- [R] GLM, LMER, GEE interpretation
Daniel Malter
- [R] question on lm or glm matrix of coeficients X test data terms
DS
- [R] question on lm or glm matrix of coeficients X test data terms
Jorge Ivan Velez
- [R] Problems with lm()
Chibisi Chima-Okereke
- [R] Problems with lm()
Daniel Malter
- [R] question on lm or glm matrix of coeficients X test data terms
DS
- [R] question on lm or glm matrix of coeficients X test data terms
DS
- [R] Basic Vector and Matrix Operations
jim holtman
- [R] list genes w/n a genomic fragment
runner
- [R] Interpreting messages when building packages
Johannes Huesing
- [R] list genes w/n a genomic fragment
Bert Gunter
- [R] odd dnorm behaviour (?)
Mike Lawrence
- [R] odd dnorm behaviour (?)
Mike Lawrence
- [R] list genes w/n a genomic fragment
Martin Morgan
- [R] odd dnorm behaviour (?)
Moshe Olshansky
- [R] odd dnorm behaviour (?)
Charles C. Berry
- [R] Sum(Random Numbers)=100
Shubha Vishwanath Karanth
- [R] Can R do this ?
Daren Tan
- [R] Sum(Random Numbers)=100
Moshe Olshansky
- [R] Sum(Random Numbers)=100
Shubha Vishwanath Karanth
- [R] Sum(Random Numbers)=100
Peng Jiang
- [R] Survey questions
Tobias Verbeke
- [R] Sum(Random Numbers)=100
Daniel Malter
- [R] Sum(Random Numbers)=100
Moshe Olshansky
- [R] Sum(Random Numbers)=100
Richard Pearson
- [R] Sum(Random Numbers)=100
Daniel Malter
- [R] Sum(Random Numbers)=100
Daniel Malter
- [R] Change in behaviour of sd()
Fiona Johnson
- [R] How to change labels in a histogram
Lord Yo
- [R] Sum(Random Numbers)=100
Bill.Venables at csiro.au
- [R] Sum(Random Numbers)=100
Peter Dalgaard
- [R] what does this warning mean ?
Peng Jiang
- [R] shading an area in a edf
squall44
- [R] How to change labels in a histogram
Philipp Pagel
- [R] package segmented problem
Alan Kelly
- [R] Sum(Random Numbers)=100
Patrick Burns
- [R] Can R do this ?
Paul Smith
- [R] Can R do this ?
Gabor Csardi
- [R] Can R do this ?
Mark Difford
- [R] Can R do this ?
Gabor Csardi
- [R] attributing values to dataframe positions following eval
Stephane Bourgeois
- [R] Problems with lm()
Chibisi Chima-Okereke
- [R] Constrained optimization
Kanak Choudhury
- [R] forecast & xreg
Vorlow Constantinos
- [R] Change legend in the 'hydrogeo' package
Tomas Lanczos
- [R] one-site competition data // curve fitting
Joerg van den Hoff
- [R] Manipulate Data (with regular expressions)
Kunzler, Andreas
- [R] Histogram with colors according to factor
Hans W. Borchers
- [R] Need ideas on how to show spikes in my data and how to code it in R
Thomas Fröjd
- [R] Multiple Plots and y Axis Labels
jonboym
- [R] Need ideas on how to show spikes in my data and how to code it in R
S Ellison
- [R] How to change labels in a histogram
S Ellison
- [R] Histogram with colors according to factor
ONKELINX, Thierry
- [R] Help with eigenvectors
Francisco Javier Santos Alamillos
- [R] RES: Sum(Random Numbers)=100
Leandro Marino
- [R] Sum(Random Numbers)=100
Hanke, Alex
- [R] Histogram with colors according to factor
Hans W. Borchers
- [R] Help with eigenvectors
Ben Bolker
- [R] Histogram with colors according to factor
ONKELINX, Thierry
- [R] workspace platform potabillity
Benjamin Otto
- [R] one-site competition data // curve fitting
Gabor Grothendieck
- [R] one-site competition data // curve fitting
Ben Bolker
- [R] Can I do regression by steps?
rlearner309
- [R] Question: Beginner stuck in a R cycle
Daniela Ottaviani
- [R] help for xvalid with external data
Giovanni Bacaro
- [R] about EM algorithm
Peng Jiang
- [R] Specific question on LDheatmap
Boks, M.P.M.
- [R] Histogram with colors according to factor
hadley wickham
- [R] attributing values to dataframe positions following eval
John Kane
- [R] about EM algorithm
Patrick Burns
- [R] time series by calendar week
collonil
- [R] Manipulate Data (with regular expressions)
oscar Linares
- [R] R package
Sergi M.Garrido
- [R] Manipulate Data (with regular expressions)
Gabor Grothendieck
- [R] R package
Duncan Murdoch
- [R] attributing values to dataframe positions following eval
Greg Snow
- [R] simulate data for lme
melanie.r
- [R] Need ideas on how to show spikes in my data and how to code it in R
Thomas Fröjd
- [R] Change language in Rcmdr
Adrian Dusa
- [R] How to draw dot plots for 2 vectors seperately
ss
- [R] Question: Beginner stuck in a R cycle
Greg Snow
- [R] Question: Beginner stuck in a R cycle
(Ted Harding)
- [R] Question: Beginner stuck in a R cycle
Gustaf Rydevik
- [R] Question: Beginner stuck in a R cycle
Rashid Nassar
- [R] time series by calendar week
stephen sefick
- [R] fisher.test
Marta Colombo
- [R] Constrained optimization
Paul Smith
- [R] time series by calendar week
Jeffrey J. Hallman
- [R] Gage R & R
Isabella Ghement
- [R] R crash with ATLAS precompiled Rblas.dll on Windows XP Core2 Duo
Law, Jason
- [R] How I count the all possible samples??
muhammad faisal
- [R] Question: Beginner stuck in a R cycle
Jorge Ivan Velez
- [R] How I count the all possible samples??
Jorge Ivan Velez
- [R] How I count the all possible samples??
John Kane
- [R] Plot
Paul Adams
- [R] making zoo objects with zoo without format argument?
stephen sefick
- [R] Plot
stephen sefick
- [R] fisher.test
Marta Colombo
- [R] extracting index list when using tapply()
hesicaia
- [R] Automatic placement of Legends
tolga.i.uzuner at jpmorgan.com
- [R] nls and "plinear" algorithm
Allan Clark
- [R] time series by calendar week
Gabor Grothendieck
- [R] making zoo objects with zoo without format argument?
Gabor Grothendieck
- [R] making zoo objects with zoo without format argument?
Gabor Grothendieck
- [R] making zoo objects with zoo without format argument?
stephen sefick
- [R] making zoo objects with zoo without format argument?
stephen sefick
- [R] Automatic placement of Legends
stephen sefick
- [R] extracting index list when using tapply()
ctu at bigred.unl.edu
- [R] making zoo objects with zoo without format argument?
Gabor Grothendieck
- [R] making zoo objects with zoo without format argument?
stephen sefick
- [R] Automatic placement of Legends
Boks, M.P.M.
- [R] Fwd: Re: extracting index list when using tapply()
ctu at bigred.unl.edu
- [R] nls and "plinear" algorithm
Duncan Murdoch
- [R] making zoo objects with zoo without format argument?
Gabor Grothendieck
- [R] calculation of entropy in R???
muhammad faisal
- [R] nls and "plinear" algorithm
Peter Dalgaard
- [R] Automatic placement of Legends
dogle
- [R] aggregate() function and na.rm = TRUE
David Afshartous
- [R] nls and "plinear" algorithm
Katharine Mullen
- [R] Change in behaviour of sd()
Rolf Turner
- [R] Sum(Random Numbers)=100
Kenn Konstabel
- [R] Automatic placement of Legends
Gregor Gorjanc
- [R] shading an area in a edf
Ray Brownrigg
- [R] calculation of entropy in R???
David Reinke
- [R] Sum(Random Numbers)=100
Carl Witthoft
- [R] Change in behaviour of sd()
Henrik Bengtsson
- [R] Change in behaviour of sd()
Duncan Murdoch
- [R] aggregate() function and na.rm = TRUE
Daniel Malter
- [R] Can I do regression by steps?
John Sorkin
- [R] Can I do regression by steps?
rlearner309
- [R] Question: Beginner stuck in a R cycle
Giovanni Petris
- [R] Change in behaviour of sd()
Peter Dalgaard
- [R] question on lm or glm matrix of coeficients X test data terms
DS
- [R] extracting index list when using tapply()
Charles C. Berry
- [R] extracting index list when using tapply()
jim holtman
- [R] question on lm or glm matrix of coeficients X test data terms
DS
- [R] Can I do regression by steps?
markleeds at verizon.net
- [R] Can I do regression by steps?
John Sorkin
- [R] cex.axis for the x axis
Pavel77
- [R] sorting a data frame by rownames
Michael Rennie
- [R] sorting a data frame by rownames
Rolf Turner
- [R] sorting a data frame by rownames
Jorge Ivan Velez
- [R] Loglikelihood for x factorial?
ctu at bigred.unl.edu
- [R] Installing R package but got Fortran 90 error
Daren Tan
- [R] Automatic placement of Legends
tolga.i.uzuner at jpmorgan.com
- [R] cex.axis for the x axis
Mark Difford
- [R] cex.axis for the x axis
Mark Difford
- [R] Help with installing add-on packages
Miha Staut
- [R] building experimental paradigm with R as "Brainard/Pelli Psych Toolbox"
guillaume chaumet
- [R] building experimental paradigm with R as "Brainard/Pelli PsychToolbox"
Ken Knoblauch
- [R] replacing value in column of data frame
Booman, M
- [R] replacing value in column of data frame
Daniel Malter
- [R] Expression in axis
Dani Valverde
- [R] Expression in axis
Daniel Malter
- [R] Expression in axis
Gabor Csardi
- [R] Parsing
Paolo Sonego
- [R] "non-sample" standard-deviation
el_eli at gmx.de
- [R] recursively divide a value to get a sequence
Anne-Marie Ternes
- [R] Expression in axis
Daniel Malter
- [R] Change in behaviour of sd()
Jim Lemon
- [R] "non-sample" standard-deviation
Daniel Malter
- [R] Question concerning Furness iteration & subprogram/modules
Mario Cools
- [R] problems using mice()
Birgitle
- [R] Automatic placement of Legends
Jim Lemon
- [R] Strptime/ date time classes
Caroline Keef
- [R] recursively divide a value to get a sequence
Daniel Malter
- [R] version problems of rkward in ubuntu hardy repository
Rainer M Krug
- [R] recursively divide a value to get a sequence
Jim Lemon
- [R] plot gam "main effect functions" in one graph
Pancrazio Bertaccini
- [R] re cursively divide a value to get a sequence
bartjoosen
- [R] recursively divide a value to get a sequence
Keith Jewell
- [R] RJDBC and OracleDriver: unable to connect
Rodrigo Santamaria
- [R] childNames for xaxis grob (grid package)
Tobias Verbeke
- [R] Automatic placement of Legends
Frank E Harrell Jr
- [R] recursively divide a value to get a sequence
Anne-Marie Ternes
- [R] recursively divide a value to get a sequence
Gabor Grothendieck
- [R] recursively divide a value to get a sequence
Berwin A Turlach
- [R] Automatic placement of Legends
tolga.i.uzuner at jpmorgan.com
- [R] replacing value in column of data frame
jim holtman
- [R] Parsing
jim holtman
- [R] netCDF to TIFF
Daniel Steinberg
- [R] extracting index list when using tapply()
hesicaia
- [R] Help with installing add-on packages
Miha Staut
- [R] recursively divide a value to get a sequence
René Capell
- [R] making zoo objects with zoo without format argument?
stephen sefick
- [R] Expression in axis
S Ellison
- [R] making zoo objects with zoo without format argument?
stephen sefick
- [R] making zoo objects with zoo without format argument?
Gabor Grothendieck
- [R] recursively divide a value to get a sequence
Wacek Kusnierczyk
- [R] Auto.key colors maintained when subsetting
David Afshartous
- [R] Parsing
Paolo Sonego
- [R] Loglikelihood for x factorial?
Ben Bolker
- [R] Summary Stats (not summary(x))
nmarti
- [R] lapply
Rajasekaramya
- [R] Summary Stats (not summary(x))
Jorge Ivan Velez
- [R] Summary Stats (not summary(x))
Gabor Grothendieck
- [R] Find the closest value in a list or matrix
R_Learner
- [R] Summary Stats (not summary(x))
Gabor Csardi
- [R] lapply
jim holtman
- [R] Summary Stats (not summary(x))
HBaize
- [R] Summary Stats (not summary(x))
nmarti
- [R] Summary Stats (not summary(x))
William Revelle
- [R] Parsing
jim holtman
- [R] gsub and "\"
Sean Davis
- [R] rJava crashes jvm
Christian Ruckert
- [R] gsub and "\"
jim holtman
- [R] gsub and "\"
Sean Davis
- [R] gsub and "\"
(Ted Harding)
- [R] build matrix with the content of one column of a data frame in function of two factors
VinceD
- [R] Parsing
Paolo Sonego
- [R] Strptime/ date time classes
jim holtman
- [R] Parsing
jim holtman
- [R] Strptime/ date time classes
Mark Difford
- [R] Port package
Jos Kaefer
- [R] rollmean()
Rheannon
- [R] Port package
roger koenker
- [R] build matrix with the content of one column of a data frame in function of two factors
VinceD
- [R] Question regarding lu in package Matrix
Ulrike Grömping
- [R] Port package
Katharine Mullen
- [R] Auto.key colors maintained when subsetting
Deepayan Sarkar
- [R] Port package
roger koenker
- [R] Strptime/ date time classes
Caroline Keef
- [R] rbinom for a matrix
ACroske
- [R] package segmented problem
milton ruser
- [R] outlining symbol in legend with blackline
stephen sefick
- [R] Question regarding lu in package Matrix
Douglas Bates
- [R] Find the closest value in a list or matrix
Henrique Dallazuanna
- [R] Find the closest value in a list or matrix
Daniel Malter
- [R] rollmean()
Gabor Grothendieck
- [R] rollmean()
stephen sefick
- [R] question on FARIMA innovations
otunno at CLEMSON.EDU
- [R] plot gam "main effect functions" in one graph
Daniel Malter
- [R] "Rotated Lat-Lon" projection in mapproj
Victor Homar
- [R] outlining symbol in legend with blackline
Yasir Kaheil
- [R] rbinom for a matrix
Erik Iverson
- [R] Strptime/ date time classes
jim holtman
- [R] garchFit problem
Shirin Safa
- [R] ftp directory
Yuri Volchik
- [R] Find the closest value in a list or matrix
Tobias Verbeke
- [R] netCDF to TIFF
Yasir Kaheil
- [R] shifting data in matrix by n rows
rcoder
- [R] Sweave figure
Georg Otto
- [R] Find the closest value in a list or matrix
Jorge Ivan Velez
- [R] rbinom for a matrix
Ben Bolker
- [R] Auto.key colors maintained when subsetting
David Afshartous
- [R] Read.table - Less rows than original data
phoebe kong
- [R] randomly select duplicated entries
Juliet Hannah
- [R] rbinom for a matrix
Dylan Beaudette
- [R] rbinom for a matrix
ACroske
- [R] rbinom for a matrix
Ben Bolker
- [R] Question regarding lu in package Matrix
Ulrike Grömping
- [R] Port package
Ben Bolker
- [R] Read.table - Less rows than original data
Ben Bolker
- [R] read.table problem
phoebe kong
- [R] rbinom for a matrix
ACroske
- [R] matplot help
Boyce, Morgan
- [R] Port package
hadley wickham
- [R] shifting data in matrix by n rows
jim holtman
- [R] rbinom for a matrix
Dylan Beaudette
- [R] Read.table - Less rows than original data
Philipp Pagel
- [R] randomly select duplicated entries
Henrique Dallazuanna
- [R] randomly select duplicated entries
jim holtman
- [R] randomly select duplicated entries
Marc Schwartz
- [R] Auto.key colors maintained when subsetting
Deepayan Sarkar
- [R] zoo and cex
stephen sefick
- [R] recursively divide a value to get a sequence
Carl Witthoft
- [R] recursively divide a value to get a sequence
Erik Iverson
- [R] zoo and cex
Marc Schwartz
- [R] Grid building in R
hippie dream
- [R] Auto.key colors maintained when subsetting
David Afshartous
- [R] Grid building in R
hadley wickham
- [R] Grid building in R
Sam Albers
- [R] use variable value as vector name
Qian R
- [R] use variable value as vector name
Erik Iverson
- [R] shifting data in matrix by n rows
rcoder
- [R] Grid building in R
Erik Iverson
- [R] Grid building in R
Sam Albers
- [R] Help navigating documentation for descriptive statistics
Ted
- [R] Grid building in R
Dylan Beaudette
- [R] Grid building in R
Sam Albers
- [R] Sweave figure
Duncan Murdoch
- [R] Help on Installing Matrix Package in Linux (Fedora)
Hyunseung Kang
- [R] Summary Stats (not summary(x))
nmarti
- [R] Help on Installing Matrix Package in Linux (Fedora)
Krzysztof Sakrejda-Leavitt
- [R] Basic help needed
Luciano La Sala
- [R] Summary Stats (not summary(x))
nmarti
- [R] Summary Stats (not summary(x))
Gabor Grothendieck
- [R] Strptime/ date time classes
Gabor Grothendieck
- [R] Basic help needed
Gabor Grothendieck
- [R] shifting data in matrix by n rows
Gabor Grothendieck
- [R] shifting data in matrix by n rows
jim holtman
- [R] Help on Installing Matrix Package in Linux (Fedora)
Marc Schwartz
- [R] childNames for xaxis grob (grid package)
Paul Murrell
- [R] “Check” problem
leeznar
- [R] Thanks!
R_Learner
- [R] version problems of rkward in ubuntu hardy repository
Vincent Goulet
- [R] Lattice: merged strips?
Mike Lawrence
- [R] Lattice: merged strips?
Mike Lawrence
- [R] Lattice: merged strips?
Duncan Mackay
- [R] Parallel R
Juan Pablo Romero Méndez
- [R] Finding Values that Occur Most Often in a Vector
Gundala Viswanath
- [R] specifying data
sprohl at na.uni-tuebingen.de
- [R] Interpolation of data
sprohl at na.uni-tuebingen.de
- [R] Finding Values that Occur Most Often in a Vector
hpages at fhcrc.org
- [R] Finding Values that Occur Most Often in a Vector
Duncan Mackay
- [R] childNames for xaxis grob (grid package)
Tobias Verbeke
- [R] “Check” problem
Peter Dalgaard
- [R] Parsing
Paolo Sonego
- [R] Operator overloading
Tine
- [R] Problem when building a test R package on PC
Briantgr
- [R] problems with rq.fit.sfn
alessia matano
- [R] re ad.table problem
Schleuh
- [R] Operator overloading
Peter Dalgaard
- [R] Thanks!
Petr PIKAL
- [R] Plot depends on conditions
mysimbaa
- [R] Sorting / editing a table
Jörg Groß
- [R] Sorting / editing a table
Wacek Kusnierczyk
- [R] Sorting / editing a table
Daniel Malter
- [R] specifying data
Daniel Malter
- [R] Sorting / editing a table
Tobias Verbeke
- [R] Interpolation of data
Daniel Malter
- [R] Interpolation of data
Daniel Malter
- [R] Interpolation of data
Daniel Malter
- [R] quantile regression estimation results
Emili Tortosa-Ausina
- [R] Odp: specifying data
Petr PIKAL
- [R] Grid building in R
Jim Lemon
- [R] quantile regression estimation results
roger koenker
- [R] version problems of rkward in ubuntu hardy repository
Rainer M Krug
- [R] problems with rq.fit.sfn
alessia matano
- [R] Bootstrap in betareg()
Leandro Marino
- [R] Turn any vector
Zroutik Zroutik
- [R] Turn any vector
Henrique Dallazuanna
- [R] Turn any vector
Gabor Csardi
- [R] Turn any vector
jim holtman
- [R] Turn any vector
jgarcia at ija.csic.es
- [R] Turn any vector
Zroutik Zroutik
- [R] Position in a vector of the last value > n
Thaden, John J
- [R] Operator overloading
hadley wickham
- [R] Operator overloading
Peter Dalgaard
- [R] build matrix with the content of one column of a data frame in function of two factors
VinceD
- [R] matplot help
Michael Rennie
- [R] Position in a vector of the last value > n
Henrique Dallazuanna
- [R] Issue with postscript figures using WinAnsi encoding
Michael Rennie
- [R] Interpolation of data
stephen sefick
- [R] rbinom for a matrix
Ben Bolker
- [R] matplot help
Gabor Grothendieck
- [R] Non-normal data issues in PhD software engineering experiment
andrewjacksonTCD
- [R] Interpolation of data
Don MacQueen
- [R] Interpolation of data
Mike Lawrence
- [R] xYplot customizing y-axis scaling
Henning Wildhagen
- [R] false discovery rate !
A Ezhil
- [R] false discovery rate !
john seers (IFR)
- [R] How to check how much memory has been used or reserved ?
Daren Tan
- [R] Lattice: merged strips?
Mike Lawrence
- [R] Non-normal data issues in PhD software engineering experiment
Andrew Jackson
- [R] ace error because of missings?
Birgitle
- [R] [R-pkgs] ppls: version 1.02 including a new data set
Nicole Kraemer
- [R] S4 class questions
Li, Xuejun
- [R] Non-normal data issues in PhD software engineering experiment
Daniel Malter
- [R] Parallel R
Martin Morgan
- [R] by() function doesn't work inside another function
Russell Ivory
- [R] S4 class questions
Martin Morgan
- [R] Non-normal data issues in PhD software engineering experiment
Gustaf Rydevik
- [R] What's the T-Value in fisher.test
DaveFrisch
- [R] embarrassingly parallel problem - simple loop solution
Chris Gaiteri
- [R] Non-normal data issues in PhD software engineering experiment
hadley wickham
- [R] Rmpi unkown input format error
Lyman, Mark
- [R] What's the T-Value in fisher.test
Peter Dalgaard
- [R] What's the T-Value in fisher.test
ctu at bigred.unl.edu
- [R] xYplot customizing y-axis scaling
Christoph Meyer
- [R] Parallel R
Luke Tierney
- [R] Help on Installing Matrix Package in Linux (Fedora)
Hyunseung Kang
- [R] xYplot customizing y-axis scaling
Ben Bolker
- [R] Sorting a matrix
Angelo Scozzarella
- [R] xYplot customizing y-axis scaling
Ben Bolker
- [R] compiling pnmath on an intel processor running mac OS 10.5
Mike Lawrence
- [R] Sorting a matrix
Jorge Ivan Velez
- [R] What's the T-Value in fisher.test
(Ted Harding)
- [R] Sorting a matrix
Erik Iverson
- [R] search with help.start
Carlisle Thacker
- [R] Sorting a matrix
Bert Gunter
- [R] Ellipsis arguments for plot.formula
Amit Ganatra
- [R] Operator overloading
Spencer Graves
- [R] compiling pnmath on an intel processor running mac OS 10.5
Luke Tierney
- [R] shifting data in matrix by n rows
rcoder
- [R] RE volution
Mariana Gamb
- [R] rounding
Korn, Ed (NIH/NCI) [E]
- [R] layout is to xyplot as ??? is to qplot
Jim Price
- [R] Interpretation of EXACT Statistical Test in finding the probability as Std. Deviations (SumP)
DaveFrisch
- [R] predict.garch problem
Shirin Safa
- [R] rounding
Rolf Turner
- [R] shifting data in matrix by n rows
Gabor Grothendieck
- [R] Interpretation of EXACT Statistical Test in finding the
(Ted Harding)
- [R] shifting data in matrix by n rows
Gabor Grothendieck
- [R] layout is to xyplot as ??? is to qplot
hadley wickham
- [R] odfWeave problem in 7.1?
Jim Porzak
- [R] R bug in the update of nlme?
Susana Esteves
- [R] Ellipsis arguments for plot.formula
Bert Gunter
- [R] odfWeave problem in 7.1?
Jim Porzak
- [R] shifting data in matrix by n rows
rcoder
- [R] Interpretation of EXACT Statistical Test in finding the
DaveFrisch
- [R] princomp loading help
Wu, Hong-Sheng
- [R] princomp loading help
Daniel Malter
- [R] princomp loading help
Bert Gunter
- [R] rounding
ctu at bigred.unl.edu
- [R] search with help.start
Marc Schwartz
- [R] rounding
Moshe Olshansky
- [R] Problems with Package Installation.
hippie dream
- [R] rounding
Moshe Olshansky
- [R] Problems with Package Installation.
Erik Iverson
- [R] Problems with Package Installation.
Rolf Turner
- [R] number of effective tests
Georg Ehret
- [R] embarrassingly parallel problem - simple loop solution
Martin Morgan
- [R] rounding
jim holtman
- [R] Position in a vector of the last value > n
jim holtman
- [R] number of effective tests
Moshe Olshansky
- [R] number of effective tests
Daniel Malter
- [R] number of effective tests
Charles C. Berry
- [R] How to output 0.405852702657738 as 0.405853 ?
Daren Tan
- [R] How to output 0.405852702657738 as 0.405853 ?
ctu at bigred.unl.edu
- [R] odfWeave problem in 7.1?
Dieter Menne
- [R] Any R package about COALESCENT THEORY/GENEOLOGICAL TREES??
muhammad faisal
- [R] Manipulate Data (with regular expressions)
Kunzler, Andreas
- [R] rounding
Jim Lemon
- [R] Start preferred RGui
marciarr
- [R] how to test this multivariate normal distribution?
domenico pestalozzi
- [R] Manipulate Data (with regular expressions)
Kenn Konstabel
- [R] Funnel plots in r
Januarius
- [R] shifting data in matrix by n rows
Gabor Grothendieck
- [R] Start preferred RGui
Keith Jewell
- [R] Start preferred RGui
Gabor Grothendieck
- [R] Manipulate Data (with regular expressions)
Gabor Grothendieck
- [R] Start preferred RGui
Ptit_Bleu
- [R] Funnel plots
Januarius
- [R] Start preferred RGui
bartjoosen
- [R] Ellipsis arguments for plot.formula
Amit Ganatra
- [R] network
Dry, Jonathan R
- [R] Ellipsis arguments for plot.formula
Gabor Grothendieck
- [R] network
Gabor Csardi
- [R] Start preferred RGui
Keith Jewell
- [R] network
Gabor Csardi
- [R] modified ks.test?
Shuhua Zhan
- [R] Start preferred RGui
Ptit_Bleu
- [R] network
Dry, Jonathan R
- [R] network
Gabor Csardi
- [R] Ellipsis arguments for plot.formula
Amit Ganatra
- [R] Ellipsis arguments for plot.formula
Gabor Grothendieck
- [R] Meaning of Positive LogLikelihood
Gundala Viswanath
- [R] Subsetting an array by a vector of dimensions
Richard Pearson
- [R] Meaning of Positive LogLikelihood
Erik Iverson
- [R] TeachingDemos question: my.symbols() alignment problems in complicated layout
maria at meteo.mcgill.ca
- [R] mpirun question with Rmpi
Erin Hodgess
- [R] More compact form of lm object that can be used for prediction?
Woolner, Keith
- [R] Comparing complex numbers
David Stoffer
- [R] Subsetting an array by a vector of dimensions
Patrick Burns
- [R] Ellipsis arguments for plot.formula
Amit Ganatra
- [R] More compact form of lm object that can be used for prediction?
Marc Schwartz
- [R] Position in a vector of the last value > n - *SOLVED*
Thaden, John J
- [R] reading in a subset of a large data set
Stacey Burrows
- [R] Subsetting an array by a vector of dimensions
Richard Pearson
- [R] GroupedData for three way randomized block. LME
hpdutra
- [R] Help with error in "if then" statement
Andrew Rominger
- [R] Comparing complex numbers
Duncan Murdoch
- [R] reading in a subset of a large data set
jim holtman
- [R] While loop
Rheannon
- [R] reading in a subset of a large data set
Bert Gunter
- [R] Any R package about COALESCENT THEORY/GENEOLOGICAL TREES??
Brad McNeney
- [R] R bug in the update of nlme?
Spencer Graves
- [R] While loop
Henrique Dallazuanna
- [R] Difficultes with grep
Fran100681
- [R] Subsetting an array by a vector of dimensions
Richard Pearson
- [R] odfWeave problem in 7.1?
Jim Porzak
- [R] plotting granular data
Neil Gupta
- [R] Difficultes with grep
jim holtman
- [R] plotting granular data
jim holtman
- [R] More compact form of lm object that can be used for prediction?
Woolner, Keith
- [R] Comparing complex numbers
David Stoffer
- [R] List help
Rajasekaramya
- [R] List help
Henrique Dallazuanna
- [R] Help with error in "if then" statement
Erik Iverson
- [R] List help
Jorge Ivan Velez
- [R] Plot multiple datasets on a VCD ternary graph
theBenjamin
- [R] List help
Rajasekaramya
- [R] More compact form of lm object that can be used for prediction?
Marc Schwartz
- [R] Subsetting an array by a vector of dimensions
Wolfgang Huber
- [R] Subsetting an array by a vector of dimensions
Kenn Konstabel
- [R] Subsetting an array by a vector of dimensions
Wolfgang Huber
- [R] data summerization etc...
sj
- [R] data summarization etc...
sj
- [R] data summerization etc...
ajay ohri
- [R] Start preferred RGui
John C Frain
- [R] Lattice: merged strips?
Deepayan Sarkar
- [R] data summarization etc...
Daniel Malter
- [R] data summarization etc...
Daniel Malter
- [R] More compact form of lm object that can be used for prediction?
Charles C. Berry
- [R] Lattice: merged strips?
Mike Lawrence
- [R] Another failed attempt to install an R package in Ubuntu
Miklos Kiss
- [R] Another packaging question
Johannes Huesing
- [R] Assoociative array?
rkevinburton at charter.net
- [R] Help with arima.sim
Christopher Gürke
- [R] Error of exp() in a dll from Fortran
Hao Ren Sr
- [R] Plot multiple datasets on a VCD ternary graph
Jim Lemon
- [R] plotting granular data
Jim Lemon
- [R] data summerization etc...
hadley wickham
- [R] Another packaging question
Uwe Ligges
- [R] Error of exp() in a dll from Fortran
Duncan Murdoch
- [R] Another failed attempt to install an R package in Ubuntu
IAIN GALLAGHER
- [R] a warning message from lmer
Lan Wei
- [R] Assoociative array?
jim holtman
- [R] data summerization etc...
Gabor Grothendieck
- [R] Position in a vector of the last value > n - *SOLVED*
jim holtman
- [R] a warning message from lmer
Douglas Bates
- [R] a warning message from lmer
Douglas Bates
- [R] Help with arima.sim
Erin Hodgess
- [R] Visualization of multiple alignments
schragas at post.tau.ac.il
- [R] Quick plotmath question
Mike Lawrence
- [R] ggplot2 book?
hpdutra
- [R] specifying data
hpdutra
- [R] Quick plotmath question
Christian Ritz
- [R] Help with error in "if then" statement
John Kane
- [R] Another failed attempt to install an R package in Ubuntu
Matti Pastell
- [R] shapiro wilk normality test
Bunny, lautloscrew.com
- [R] Quick plotmath question
Gabor Grothendieck
- [R] shapiro wilk normality test
Robert A LaBudde
- [R] shapiro wilk normality test
Bunny, lautloscrew.com
- [R] Assoociative array?
rkevinburton at charter.net
- [R] Reading Multi-value data fields for descriptive analysis
Hohm, Dale
- [R] Quick plotmath question
Gabor Grothendieck
- [R] Assoociative array?
Duncan Murdoch
- [R] shapiro wilk normality test
Mark Leeds
- [R] Reading Multi-value data fields for descriptive analysis (resend)
Hohm, Dale
- [R] Reading Multi-value data fields for descriptive analysis
jim holtman
- [R] odfWeave problem in 7.1?
Prof Brian Ripley
- [R] shapiro wilk normality test
Robert A LaBudde
- [R] R-outlet: Journal of Statistical Software
Jan de Leeuw
- [R] Excel Trend Function
Felipe Carrillo
- [R] Installing RWinEdt
rkevinburton at charter.net
- [R] Assoociative array?
rkevinburton at charter.net
- [R] How to build a package which loads Rgraphviz (if installed)...
Søren Højsgaard
- [R] Excel Trend Function
Daniel Malter
- [R] Assoociative array?
rkevinburton at charter.net
- [R] Position in a vector of the last value > n - *SOLVED*
Thaden, John J
- [R] Assoociative array?
jim holtman
- [R] How to build a package which loads Rgraphviz (if installed)...
William Revelle
- [R] A (not so) Short Introduction to S4
Christophe Genolini
- [R] How to build a package which loads Rgraphviz (if installed)...
Søren Højsgaard
- [R] Assoociative array?
Duncan Murdoch
- [R] How to build a package which loads Rgraphviz (if installed)...
Duncan Murdoch
- [R] How to build a package which loads Rgraphviz (if installed)...
Søren Højsgaard
- [R] a warning message from lmer
Lan Wei
- [R] How to build a package which loads Rgraphviz (if installed)...
William Revelle
- [R] Assoociative array?
rkevinburton at charter.net
- [R] Assoociative array?
Duncan Murdoch
- [R] Assoociative array?
jim holtman
- [R] Another failed attempt to install an R package in Ubuntu
Vincent Goulet
- [R] Reading Multi-value data fields for descriptive analysis
Hohm, Dale
- [R] Assoociative array?
rkevinburton at charter.net
- [R] shapiro wilk normality test
C.H.
- [R] Assoociative array?
rkevinburton at charter.net
- [R] Excel Trend Function
paulandpen
- [R] R crash with ATLAS precompiled Rblas.dll on Windows XP Core2 Duo
Prof Brian Ripley
- [R] How to build a package which loads Rgraphviz (if installed)...
Uwe Ligges
- [R] R crash with ATLAS precompiled Rblas.dll on Windows XP Core2 Duo
Uwe Ligges
- [R] Installing RWinEdt
Uwe Ligges
- [R] shapiro wilk normality test
Marta Colombo
- [R] Difficultes with grep
Fran100681
- [R] Assoociative array?
jim holtman
- [R] Reading Multi-value data fields for descriptive analysis
jim holtman
- [R] shapiro wilk normality test
Frank E Harrell Jr
- [R] shapiro wilk normality test
(Ted Harding)
- [R] shapiro wilk normality test
Charles Annis, P.E.
- [R] shapiro wilk normality test
Berwin A Turlach
- [R] Another packaging question
Johannes Huesing
- [R] initialize a factor vector
Johannes Huesing
- [R] Another packaging question
Uwe Ligges
- [R] shapiro wilk normality test
(Ted Harding)
- [R] how do I read only specific columns using read.csv or other read function
Juliet Hannah
- [R] mpirun question with Rmpi
Martin Morgan
- [R] shapiro wilk normality test
Frank E Harrell Jr
- [R] initialize a factor vector
Gavin Simpson
- [R] Excel Trend Function
Daniel Malter
- [R] rm anova
korhan ozkan
- [R] Quick plotmath question
Mike Lawrence
- [R] initialize a factor vector
Johannes Huesing
- [R] shapiro wilk normality test
Johannes Huesing
- [R] how do I read only specific columns using read.csv or other read function
Charles C. Berry
- [R] (no subject)
Paul Adams
- [R] (no subject)
jim holtman
- [R] shapiro wilk normality test
(Ted Harding)
- [R] stem and leaf plot: how to edit the stem-values
Jörg Groß
- [R] shapiro wilk normality test
Johannes Huesing
- [R] Assoociative array?
rkevinburton at charter.net
- [R] Installing RWinEdt
rkevinburton at charter.net
- [R] any way to set defaults for par?
Carl Witthoft
- [R] Difficultes with grep
Charles C. Berry
- [R] Assoociative array?
jim holtman
- [R] Difficultes with grep
jim holtman
- [R] shapiro wilk normality test
(Ted Harding)
- [R] any way to set defaults for par?
jim holtman
- [R] Reading Multi-value data fields for descriptive analysis
Hohm, Dale
- [R] Moran's I test- Ordinal Logistic Regression Model
Rees, Lisa Marie (MU-Student)
- [R] Moran's I- Ordinal Logistic Regression
Lisa Rees
- [R] Reading Multi-value data fields for descriptive analysis
jim holtman
- [R] Computing row means for sets of 2 columns
Daren Tan
- [R] Computing row means for sets of 2 columns
Henrik Bengtsson
- [R] stem and leaf plot: how to edit the stem-values
Duncan Murdoch
- [R] Off topic: Tcl/Tk outside R.
Rolf Turner
- [R] stem and leaf plot: how to edit the stem-values
Rolf Turner
- [R] Computing row means for sets of 2 columns
Daren Tan
- [R] Using Internals via their compiled sources
rnoob
- [R] source code for R-dev packages
Mark Kimpel
- [R] How to extract folowing data?
Megh Dal
- [R] Off topic: Tcl/Tk outside R.
Peter Dalgaard
- [R] source code for R-dev packages
Prof Brian Ripley
- [R] false discovery rate !
john seers (IFR)
- [R] Question regarding lmer vs glmmPQL vs glmm.admb model on a negative binomial distributed dependent variable
eugen pircalabelu
- [R] Installing RWinEdt
Uwe Ligges
- [R] Loop problem
fernanda lopez
- [R] rm(l*)
Oehler, Friderike (AGPP)
- [R] rm(l*)
Gabor Csardi
- [R] Loop problem
Dimitris Rizopoulos
- [R] Loop problem
Daniel Malter
- [R] Strptime/ date time classes
Caroline Keef
- [R] eval.wih.vis
mysimbaa
- [R] rm(l*)
Prof Brian Ripley
- [R] nlme, lme( ) convergence and selection of effects
Thiago Cortez Costa
- [R] Frequency-Table on Group Level - Multi Level Analysis
Kunzler, Andreas
- [R] "Reasonable doubt" - was "Re: shapiro wilk normality test"
S Ellison
- [R] how to correlate nominal variables?
Timo Stolz
- [R] Tissue specific genes by ANOVA?
icebreake
- [R] Tissue specific genes by ANOVA?
icebreake
- [R] How to load stats4 package
Surendra champanerkar
- [R] How to extract folowing data?
Ben Tupper
- [R] options() question for displaying numbers in the GUI
tolga.i.uzuner at jpmorgan.com
- [R] options() question for displaying numbers in the GUI
Henrique Dallazuanna
- [R] options() question for displaying numbers in the GUI
tolga.i.uzuner at jpmorgan.com
- [R] how to correlate nominal variables?
Daniel Malter
- [R] Loop problem
Gabor Grothendieck
- [R] How to load stats4 package
Duncan Murdoch
- [R] aggregate months to years
Oehler, Friderike (AGPP)
- [R] aggregate months to years
Henrique Dallazuanna
- [R] Odp: aggregate months to years
Petr PIKAL
- [R] Can't compile in HPUX 11.31 on IA64
Jackson,Daniel
- [R] ampersand char in the path causing error message when running rscript.bat
Zroutik Zroutik
- [R] applying complex functions by groups
Finch, W. Holmes
- [R] swap_tail macro in pnorm.c
Adam B. Thompson
- [R] A question about using function plot
Jason Liao
- [R] macros in R
Erin Hodgess
- [R] macros in R
Chuck Cleland
- [R] Tissue specific genes by ANOVA?
Marcelo Luiz de Laia
- [R] creating axis of the plot before data are plotted
Zroutik Zroutik
- [R] .Last() and namespace
Ralf Tautenhahn
- [R] Help with an error message
naw3 at duke.edu
- [R] creating axis of the plot before data are plotted
stephen sefick
- [R] Help with an error message
stephen sefick
- [R] Strptime/ date time classes
Mark Difford
- [R] More compact form of lm object that can be used for prediction?
Woolner, Keith
- [R] Off topic: Tcl/Tk outside R.
R P Herrold
- [R] Tissue specific genes by ANOVA?
icebreake
- [R] A question about using function plot
Sarah Goslee
- [R] A question about using function plot
Henrique Dallazuanna
- [R] A question about using function plot
Chuck Cleland
- [R] applying complex functions by groups
jim holtman
- [R] A question about using function plot
Robert Baer
- [R] A question about using function plot
Richard M. Heiberger
- [R] dll problem
stephenb
- [R] R Commander question
Darin Brooks
- [R] Backslash in sub pattern?
Stephan Kolassa
- [R] Backslash in sub pattern?
Marc Schwartz
- [R] .First and .Rprofile won't run on startup
Susan Amrose
- [R] Sweave, backslash in sub pattern? was: Backslash in sub pattern?
Stephan Kolassa
- [R] Analysis of poorly replicated array data
Eli Meyer
- [R] Sweave, backslash in sub pattern? was: Backslash in sub pattern?
Duncan Murdoch
- [R] dll problem
Prof Brian Ripley
- [R] Sweave, backslash in sub pattern? was: Backslash in sub pattern?
Stephan Kolassa
- [R] Sweave, backslash in sub pattern? was: Backslash in sub pattern?
Marc Schwartz
- [R] Difficultes with grep
Fran100681
- [R] Off topic: Tcl/Tk outside R.
Rolf Turner
- [R] any way to set defaults for par?
Greg Snow
- [R] .First and .Rprofile won't run on startup
Rolf Turner
- [R] Tissue specific genes by ANOVA?
Marcelo Luiz de Laia
- [R] .First and .Rprofile won't run on startup
Bryan Hanson
- [R] Analysis of poorly replicated array data
Wolfgang Huber
- [R] Off topic: Tcl/Tk outside R.
Rolf Turner
- [R] statistics question about a statement in julian faraway's "extending the linear model with R" text
markleeds at verizon.net
- [R] R Commander question
John Kane
- [R] shapiro wilk normality test
Greg Snow
- [R] R Commander question
Darin Brooks
- [R] statistics question about a statement in julian faraway's "extending the linear model with R" text
Greg Snow
- [R] statistics question about a statement in julian faraway's "extending the linear model with R" text
Duncan Murdoch
- [R] Function to create variables with prefix
Moira Burke
- [R] Data Manipulations and SQL
Willa Wei
- [R] question about a small "for" loop
Wolfgang Huber
- [R] statistics question about a statement in julian faraway's "extending the linear model with R" text
Peter Dalgaard
- [R] Convert data set to data frame
Willa Wei
- [R] question about a small "for" loop
milton ruser
- [R] Extract and plot array from data
theBenjamin
- [R] Insurance review statistical methods
Kenneth Roy Cabrera Torres
- [R] rgl.snapshot on linux produces colored lines only
Matt
- [R] creating axis of the plot before data are plotted
Zroutik Zroutik
- [R] [Fwd: Re: Insurance review statistical methods]
Kenneth Roy Cabrera Torres
- [R] question about a small "for" loop
Christopher W. Ryan
- [R] creating axis of the plot before data are plotted
stephen sefick
- [R] modeling binary response variables
Kevin J Emerson
- [R] Data Manipulations and SQL
Gabor Grothendieck
- [R] position of a specific character
Hua Li
- [R] position of a specific character
Erik Iverson
- [R] position of a specific character
Hua Li
- [R] long data frame selection error
Rheannon
- [R] Convert data set to data frame
jim holtman
- [R] question about a small "for" loop
Christopher W. Ryan
- [R] modeling binary response variables
Daniel Malter
- [R] modeling binary response variables
Simon Blomberg
- [R] r^2 for SSasymp?
Robert Terwilliger
- [R] modeling binary response variables
Daniel Malter
- [R] modeling binary response variables
Simon Blomberg
- [R] Assoociative array?
rkevinburton at charter.net
- [R] Assoociative array?
jim holtman
- [R] Assoociative array?
rkevinburton at charter.net
- [R] [Ask]Robust Buckley-James like estimator
abdul kudus
- [R] meaning of tests presented in anova(ols(...)) {Design package}
Dylan Beaudette
- [R] enscript states file for R scripts?
cmr.Pent at gmail.com
- [R] Proxy again, this time on a Mac
LostInTimeAndSpace
- [R] position of a specific character
Prof Brian Ripley
- [R] Supressing printing from a function: ecdf
tolga.i.uzuner at jpmorgan.com
- [R] Supressing printing from a function: ecdf
Patrick Burns
- [R] Proxy again, this time on a Mac
Prof Brian Ripley
- [R] Supressing printing from a function: ecdf
Prof Brian Ripley
- [R] enscript states file for R scripts?
hadley wickham
- [R] meaning of tests presented in anova(ols(...)) {Design package}
Mark Difford
- [R] Supressing printing from a function: ecdf
Ivar Herfindal
- [R] Odd behavior of remove command
Dennis Fisher
- [R] enscript states file for R scripts?
cmr.Pent at gmail.com
- [R] long data frame selection error
jim holtman
- [R] Function to create variables with prefix
Uwe Ligges
- [R] Supressing printing from a function: ecdf
tolga.i.uzuner at jpmorgan.com
- [R] modeling binary response variables
Daniel Malter
- [R] Assoociative array?
jim holtman
- [R] tryCatch - return from function to main script
Anne-Marie Ternes
- [R] Layers in graphs
Thomas Fröjd
- [R] Insurance review statistical methods
Yasir Kaheil
- [R] Insurance review statistical methods
Yasir Kaheil
- [R] Layers in graphs
René Capell
- [R] linear and non linear regression in 3D !
Param Priya Singh
- [R] Regression problem
Angila Albaros
- [R] Mapping data onto 1-10 score
rcoder
- [R] Mapping data onto score
rcoder
- [R] Layers in graphs
Thomas Fröjd
- [R] Assoociative array?
rkevinburton at charter.net
- [R] playwith package crashes on Mac
Michael Kubovy
- [R] Assoociative array?
rkevinburton at charter.net
- [R] Assoociative array?
rkevinburton at charter.net
- [R] creating axis of the plot before data are plotted -- solved
Zroutik Zroutik
- [R] manipulating (extracting) data from distance matrices
Michael Rennie
- [R] Exporting an list()
Leandro Marino
- [R] Exporting an list()
Henrique Dallazuanna
- [R] manipulating (extracting) data from distance matrices
stephen sefick
- [R] enscript states file for R scripts?
Dirk Eddelbuettel
- [R] Font quality in base graphics
willemf
- [R] Exporting an list()
Jorge Ivan Velez
- [R] manipulating (extracting) data from distance matrices
Michael Rennie
- [R] Random Forest %var(y)
Liaw, Andy
- [R] Problem installing R on openSUSE 10.3
A Ezhil
- [R] playwith package crashes on Mac
Felix Andrews
- [R] DOE for logistic models
Jeremy MAZET
- [R] randomForest outlier
Birgitle
- [R] long data frame selection error
John Kane
- [R] extracting elements from print object of Manova()
Michael Rennie
- [R] Regression problem
Patrick Burns
- [R] counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"
Daren Tan
- [R] counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"
Ken Knoblauch
- [R] counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"
Henrik Bengtsson
- [R] manipulating (extracting) data from distance matrices
Jon Olav Skoien
- [R] manipulating (extracting) data from distance matrices
Sarah Goslee
- [R] manipulating (extracting) data from distance matrices
Michael Rennie
- [R] Font quality in base graphics
Jeffrey Horner
- [R] counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"
Wolfgang Huber
- [R] Problem installing R on openSUSE 10.3
Detlef Steuer
- [R] counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"
Patrick Aboyoun
- [R] Calculating Stream Metabolism
stephen sefick
- [R] sunrise sunset calculations
stephen sefick
- [R] Problem installing R on openSUSE 10.3
A Ezhil
- [R] sunrise sunset calculations
Chuck Cleland
- [R] Iterations
rkevinburton at charter.net
- [R] aov error with large data set
Mike Lawrence
- [R] counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"
Riley, Steve
- [R] sunrise sunset calculations
stephen sefick
- [R] Iterations
Stephan Kolassa
- [R] Iterations
Jeff Newmiller
- [R] Iterations
Michael Rennie
- [R] Iterations
Michael Rennie
- [R] Iterations
Erik Iverson
- [R] Regression problem
Douglas Bates
- [R] Help with maptools sunriset()
stephen sefick
- [R] Regression problem
Erik Iverson
- [R] extracting elements from print object of Manova()
Jorge Ivan Velez
- [R] INSEED Statistics Workshop on Bayesian statistics using OpenBUGS and R
INSEED statistics workshop
- [R] INSEED statistics workshop on Statistical Models and Practices in Epidemiology (using R)
INSEED statistics workshop
- [R] .First and .Rprofile won't run on startup
Susan Amrose
- [R] code reduction (if anyone feels like it)
stephen sefick
- [R] Iterations
rkevinburton at charter.net
- [R] how to get confidential interval for classification accuracy using 10-fold validation in svm package
larry88
- [R] matplot help
Boyce, Morgan
- [R] how to get confidential interval for classification accuracy using 10-fold validation in svm package
larry88
- [R] Font quality in base graphics
willemf
- [R] Iterations
rkevinburton at charter.net
- [R] POSIXct extract time
stephen sefick
- [R] generalized spatial autoregressive lag model
De Tuimelaar
- [R] POSIXct extract time
stephen sefick
- [R] POSIXct extract time
Henrique Dallazuanna
- [R] Font quality in base graphics
Mark Difford
- [R] Iterations
Erik Iverson
- [R] Iterations
Nordlund, Dan (DSHS/RDA)
- [R] sem & testing multiple hypotheses with BIC
Donald Braman
- [R] Font quality in base graphics
Mike Prager
- [R] Mapping data onto score
Ben Tupper
- [R] Filtering output
rkevinburton at charter.net
- [R] Iterations
Rolf Turner
- [R] playwith package crashes on Mac
Michael Lawrence
- [R] Melt (reshape) question
Steve Murray
- [R] Mapping data onto score
rcoder
- [R] Mapping data onto score
Ben Tupper
- [R] Row Sum, exclude positive values
Rheannon
- [R] Filtering output
jim holtman
- [R] What package to use to create a GUI
Judith Flores
- [R] What package to use to create a GUI
Bert Gunter
- [R] Melt (reshape) question
jim holtman
- [R] code reduction (if anyone feels like it)
jim holtman
- [R] Melt (reshape) question
hadley wickham
- [R] tryCatch - return from function to main script
jim holtman
- [R] Melt (reshape) question
Steve Murray
- [R] Mapping data onto score
rcoder
- [R] Off topic: Tcl/Tk outside R.
Jim Lemon
- [R] Convert data set to data frame
Jim Lemon
- [R] Exporting an list()
Jim Lemon
- [R] code reduction (if anyone feels like it)
stephen sefick
- [R] Mapping data onto 1-10 score
Jim Lemon
- [R] Row Sum, exclude positive values
Jorge Ivan Velez
- [R] New Zealand Maps
Tom Love
- [R] implementation of Prentice method in cch()
Jin Wang
- [R] Row Sum, exclude positive values
Jim Lemon
- [R] New Zealand Maps
Ray Brownrigg
- [R] Row Sum, exclude positive values
Nordlund, Dan (DSHS/RDA)
- [R] New Zealand Maps
Ray Brownrigg
- [R] R logo
Christophe Genolini
- [R] code reduction (if anyone feels like it)
jim holtman
- [R] code reduction (if anyone feels like it)
jim holtman
- [R] meaning of tests presented in anova(ols(...)) {Design package}
Frank E Harrell Jr
- [R] Help Updating and Installing R Packages
Tariq Perwez
- [R] How to extract component number of RMSEP in RMSEP plot
Jason Lee
- [R] Off-topic - Data needed
Bogaso Cristofer
- [R] Insurance review statistical methods
Vincent Goulet
- [R] Help Updating and Installing R Packages
Vincent Goulet
- [R] negative P-values with shapiro.test
Mark Cowley
- [R] Simulate data with binary outcome
Steve Frost
- [R] Problem installing R on openSUSE 10.3
Detlef Steuer
- [R] eval.wih.vis
mysimbaa
- [R] Howto view function's source code of an installed package
Gundala Viswanath
- [R] Regression problem
Angila Albaros
- [R] Font quality in base graphics
willemf
- [R] R logo
Martin Maechler
- [R] Howto view function's source code of an installed package
Paul Hiemstra
- [R] Group level frequencies
Kunzler, Andreas
- [R] R logo
cgenolin at u-paris10.fr
- [R] Group level frequencies
Dimitris Rizopoulos
- [R] Group level frequencies
jim holtman
- [R] Font quality in base graphics
Mark Difford
- [R] problem
silvia narduzzi
- [R] Font quality in base graphics
Mark Difford
- [R] Font quality in base graphics
Gabor Csardi
- [R] Font quality in base graphics
Gabor Csardi
- [R] barchart with bars attached to y=0-line
Henning Wildhagen
- [R] code reduction (if anyone feels like it)
stephen sefick
- [R] date to decimal date conversion
Yogesh Tiwari
- [R] How to extract component number of RMSEP in RMSEP plot
Jason Lee
- [R] barchart with bars attached to y=0-line
Gabor Grothendieck
- [R] randomForest outlier
Liaw, Andy
- [R] R-source code of a function
arezoo bagheri
- [R] randomForest outlier
Birgit Lemcke
- [R] R-source code of a function
Duncan Murdoch
- [R] NAMESPACE vs internal.Rd
cgenolin at u-paris10.fr
- [R] randomForest outlier
Birgit Lemcke
- [R] NAMESPACE vs internal.Rd
Berwin A Turlach
- [R] NAMESPACE vs internal.Rd
cgenolin at u-paris10.fr
- [R] extracting elements from print object of Manova()
Michael Friendly
- [R] NAMESPACE vs internal.Rd
Berwin A Turlach
- [R] Output design question
Michael Kubovy
- [R] Help regarding arules package
Daniel Wagner
- [R] Forecasting enrollments with fuzzy time series
Kate
- [R] Output design question
Henrique Dallazuanna
- [R] negative P-values with shapiro.test
Martin Maechler
- [R] Problem with mpi.close.Rslaves()
Lyman, Mark
- [R] Likelihood ratio test between glm and glmer fits
COREY SPARKS
- [R] NAMESPACE vs internal.Rd
cgenolin at u-paris10.fr
- [R] Confidence bands for model estimates using ns() spline basis
Assaf oron
- [R] Help with rpart.predict?
L. Jay Roberts
- [R] barchart with bars attached to y=0-line
Deepayan Sarkar
- [R] date to decimal date conversion
Gabor Grothendieck
- [R] Likelihood ratio test between glm and glmer fits
Dimitris Rizopoulos
- [R] aov error with large data set
Peter Dalgaard
- [R] gstat problem with lidar data
Alessandro
- [R] Mapping data onto score
rcoder
- [R] Mapping data onto score
rcoder
- [R] help with bivariate density plot question
Daniela Carollo
- [R] Mapping data onto score
jim holtman
- [R] Mapping data onto score
Bert Gunter
- [R] gstat problem with lidar data
Dylan Beaudette
- [R] RSQLite maximum table size
Vidhu Choudhary
- [R] Labelling curves on graphs
(Ted Harding)
- [R] RSQLite maximum table size
Gabor Grothendieck
- [R] Labelling curves on graphs
Austin, Matt
- [R] Labelling curves on graphs
(Ted Harding)
- [R] R logo
stefano iacus
- [R] R: gstat problem with lidar data
Dylan Beaudette
- [R] spectral decomposition for near-singular pd matrices
Prasenjit Kapat
- [R] Function to verify existence of an R object
Judith Flores
- [R] Function to verify existence of an R object
Bert Gunter
- [R] Function to verify existence of an R object
Duncan Murdoch
- [R] Function to verify existence of an R object
Earl F. Glynn
- [R] R logo
Christophe Genolini
- [R] Labelling curves on graphs
Barry Rowlingson
- [R] Stratified random sample
lamack lamack
- [R] R: R: gstat problem with lidar data
Alessandro
- [R] 回复: cch() and coxph() for case-cohort
Jin Wang
- [R] spectral decomposition for near-singular pd matrices
Moshe Olshansky
- [R] plot(linear model) without lines
cryan at binghamton.edu
- [R] spectral decomposition for near-singular pd matrices
Prasenjit Kapat
- [R] Stratified random sample
Rolf Turner
- [R] create a function from a model
jp d
- [R] Stratified random sample
Daniel Malter
- [R] How to extract component number of RMSEP in RMSEP plot
Jason Lee
- [R] Stratified random sample
Rolf Turner
- [R] spectral decomposition for near-singular pd matrices
Moshe Olshansky
- [R] Help regarding arules package
jim holtman
- [R] Location of HTML help files
Jan Smit
- [R] Labelling curves on graphs
Frank E Harrell Jr
- [R] Location of HTML help files
Henrik Bengtsson
- [R] Location of HTML help files
Jan Smit
- [R] Fw: how i can install Rgraphviz in R2.7.1
haani hanni
- [R] shapiro wilk normality test
Emmanuel Charpentier
- [R] Fw: how i can install Rgraphviz in R2.7.1
Uwe Ligges
- [R] Labelling curves on graphs
Barry Rowlingson
- [R] plot(linear model) without lines
Uwe Ligges
- [R] Likelihood ratio test between glm and glmer fits
Rune Haubo
- [R] Histogram with two colors depending on condition
Mohammad Ehsanul Karim
- [R] Histogram with two colors depending on condition
jim holtman
- [R] help with bivariate density plot question
Mark Difford
- [R] How to compute loglikelihood of Lognormal distribution
Gundala Viswanath
- [R] Histogram with two colors depending on condition
hadley wickham
- [R] calculate differences - strange outcome
Kunzler, Andreas
- [R] model.tables standard errors
iwhite at staffmail.ed.ac.uk
- [R] Odp: calculate differences - strange outcome
Petr PIKAL
- [R] calculate differences - strange outcome
Berwin A Turlach
- [R] calculate differences - strange outcome
Mark Difford
- [R] calculate differences - strange outcome
Duncan Murdoch
- [R] NAMESPACE vs internal.Rd
Berwin A Turlach
- [R] Likelihood ratio test between glm and glmer fits
Douglas Bates
- [R] Labelling curves on graphs
Frank E Harrell Jr
- [R] fastICA
Mikhail Spivakov
- [R] barchart with bars attached to y=0-line
Henning Wildhagen
- [R] spliting a string
Kurapati, Ravichandra (Ravichandra)
- [R] histogram plot default
Xin
- [R] barchart with bars attached to y=0-line
Felix Andrews
- [R] spliting a string
Jim Lemon
- [R] how to split the string
Kurapati, Ravichandra (Ravichandra)
- [R] float and double precision with C code
JS Ubei
- [R] spliting a string
Wacek Kusnierczyk
- [R] float and double precision with C code
jim holtman
- [R] Problems with lm()
Christoph Scherber
- [R] Re : float and double precision with C code
JS Ubei
- [R] lm() question
Christoph Scherber
- [R] Re : Re : float and double precision with C code
JS Ubei
- [R] errors using step function
silvia narduzzi
- [R] Comparing differences in AUC from 2 different models
Monica Pisica
- [R] Graph
Marco Chiapello
- [R] Colours in R
Leandro Marino
- [R] Colours in R
Duncan Murdoch
- [R] RES: Colours in R
Leandro Marino
- [R] Problem with mpi.close.Rslaves()
Lyman, Mark
- [R] Odp: Colours in R
Petr PIKAL
- [R] Odp: Graph
Petr PIKAL
- [R] Histogram with two colors depending on condition
Greg Snow
- [R] enscript states file for R scripts?
Peter Dalgaard
- [R] Sampling distribution (PDF & CDF) of correlation
Mike Lawrence
- [R] Newbie's question about lm
Ptit_Bleu
- [R] Colours in R
Earl F. Glynn
- [R] help with data layout
Iain Gallagher
- [R] Hiding information about functions in newly developed packages
Tudor Bodea
- [R] Sampling distribution (PDF & CDF) of correlation
Maria Rizzo
- [R] keeping seperate row.names
Patrick Richardson
- [R] help with data layout
Erik Iverson
- [R] Can mvtnorm calculate a sequence of probabilities?
di jianing
- [R] help with data layout
Henrique Dallazuanna
- [R] help with data layout
Stephen Tucker
- [R] negative P-values with shapiro.test
Martin Maechler
- [R] help with data layout
jim holtman
- [R] Hiding information about functions in newly developed packages
Peter Dalgaard
- [R] help with data layout
Mike Lawrence
- [R] Hiding information about functions in newly developed packages
Bert Gunter
- [R] Hiding information about functions in newly developed packages
Marc Schwartz
- [R] Labelling curves on graphs
(Ted Harding)
- [R] REvolution computing
Mariana Carla Gambarotta
- [R] Display variables when running a script
naw3 at duke.edu
- [R] Comparing differences in AUC from 2 different models
Frank E Harrell Jr
- [R] Display variables when running a script
jim holtman
- [R] REvolution computing
Marc Schwartz
- [R] Display variables when running a script
Stephan Kolassa
- [R] Display variables when running a script
Erik Iverson
- [R] ubuntu and rgl package vs suse ?? static plots
H. Paul Benton
- [R] ubuntu and rgl package vs suse ?? static plots
Duncan Murdoch
- [R] ubuntu and rgl package vs suse ?? static plots
H. Paul Benton
- [R] Sampling distribution (PDF & CDF) of correlation
Charles C. Berry
- [R] Matching Up Values
Steve Murray
- [R] nested calls, variable scope
Jacob Wegelin
- [R] Matching Up Values
Peter Alspach
- [R] smooth.spline
rkevinburton at charter.net
- [R] nested calls, variable scope
Jacob Wegelin
- [R] Help with data layout - Thanks
Iain Gallagher
- [R] Matching Up Values
Rolf Turner
- [R] Newbie's question about lm
Mark Difford
- [R] combining lists of pairs
olvrmrs at aol.com
- [R] Function to create variables with prefix
Moira Burke
- [R] REvolution computing
David Henderson
- [R] Problem with TLC/TK on Ubuntu
Davide Massidda
- [R] combining lists of pairs
Charles C. Berry
- [R] Problem with TLC/TK on Ubuntu
Dirk Eddelbuettel
- [R] Problem with TLC/TK on Ubuntu
Erik Iverson
- [R] Problem with TLC/TK on Ubuntu
Davide Massidda
- [R] How to convert/map jacktest results to dataframe or file
Jason Lee
- [R] smooth.spline
Spencer Graves
- [R] Matching Up Values
hadley wickham
- [R] size and coding error in plot ?
shetumi at aim.com
- [R] matrix multiplication question
Murali K
- [R] size and coding error in plot ?
shetumi at aim.com
- [R] Function to create variables with prefix
jim holtman
- [R] size and coding error in plot ?
hadley wickham
- [R] size and coding error in plot ?
Marc Schwartz
- [R] matrix multiplication question
Duncan Murdoch
- [R] matrix multiplication question
Tsjerk Wassenaar
- [R] Installation of garchOxFit
Charlotte Falk Mogensen
- [R] function "eigen" AND Minitab
SH.Chou
- [R] column wise paste of data.frames
Sebastian Weber
- [R] function "eigen" AND Minitab
Bill.Venables at csiro.au
- [R] column wise paste of data.frames
Dimitris Rizopoulos
- [R] column wise paste of data.frames
Patrick Burns
- [R] function "eigen" AND Minitab
Patrick Burns
- [R] probleme with R CMD check
Christophe Genolini
- [R] Equation sequencing
Stuart Nettleton
- [R] probleme with R CMD check
Martin Maechler
- [R] matrix multiplication question
Doran, Harold
- [R] t-test for multiple variables
Henning Wildhagen
- [R] REvolution computing
Gregory R. Warnes
- [R] t-test for multiple variables
Simon Anders
- [R] finding "chuncks" of data that have no NA s
stephen sefick
- [R] RStat version 2.7.2 now available
Gregory R. Warnes
- [R] Matching Up Values
Steve Murray
- [R] t-test for multiple variables
Henning Wildhagen
- [R] REvolution computing
Uwe Ligges
- [R] Correction: RStat version 2.7.*1* now available
Gregory Warnes
- [R] name returned by lapply
Antje
- [R] finding "chuncks" of data that have no NA s
Gabor Grothendieck
- [R] name returned by lapply
Gavin Simpson
- [R] Reading SPSS .por files
Jose Iparraguirre D'Elia
- [R] name returned by lapply
Antje
- [R] generate repeats of a vector's elements
Chaofeng Kou
- [R] probleme with R CMD check
cgenolin at u-paris10.fr
- [R] finding "chuncks" of data that have no NA s
stephen sefick
- [R] Change font-face in title
Albin Blaschka
- [R] name returned by lapply
Gavin Simpson
- [R] generate repeats of a vector's elements
Antje
- [R] generate repeats of a vector's elements
Dimitris Rizopoulos
- [R] finding "chuncks" of data that have no NA s
Gabor Grothendieck
- [R] only "T" becomes logical colum with read.table
Luis F
- [R] name returned by lapply
Antje
- [R] only "T" becomes logical colum with read.table
Henrique Dallazuanna
- [R] finding "chuncks" of data that have no NA s
stephen sefick
- [R] source code functions
stephen sefick
- [R] Reading SPSS .por files
Prof Brian Ripley
- [R] source code functions
Henrique Dallazuanna
- [R] source code functions
Gavin Simpson
- [R] A neural network problem---neuralnet package
Shubha Vishwanath Karanth
- [R] creating names for lists
tolga.i.uzuner at jpmorgan.com
- [R] creating names for lists
Henrique Dallazuanna
- [R] name returned by lapply
Antje
- [R] smooth.spline
Roland Rau
- [R] errors using step function
silvia narduzzi
- [R] Problem with TLC/TK on Ubuntu
Roland Rau
- [R] Reading SPSS .por files
Jose Iparraguirre D'Elia
- [R] Reading SPSS .por files
Prof Brian Ripley
- [R] creating names for lists
tolga.i.uzuner at jpmorgan.com
- [R] Landscape mode for pdf
tolga.i.uzuner at jpmorgan.com
- [R] Reading SPSS .por files
Jose Iparraguirre D'Elia
- [R] manipulate a matrix2
Jon Hak
- [R] smooth.spline
Spencer Graves
- [R] Reading SPSS .por files
Prof Brian Ripley
- [R] dataedit
Stephen Kennedy
- [R] re ad and check table
mysimbaa
- [R] REvolution computing
Charles Annis, P.E.
- [R] Landscape mode for pdf
Johannes Huesing
- [R] manipulate a matrix2
jim holtman
- [R] cbind help
Rajasekaramya
- [R] cbind help
Henrique Dallazuanna
- [R] re ad and check table
Henrique Dallazuanna
- [R] Landscape mode for pdf
jim holtman
- [R] par("din") vs dev.size()
Sarah Goslee
- [R] How to cut data elements included in a text line
Christine A.
- [R] REvolution computing
Warnes, Gregory R.
- [R] Reading SPSS .por files
Peter Dalgaard
- [R] Landscape mode for pdf
tolga.i.uzuner at jpmorgan.com
- [R] Polynomial Approximation with Exponential Kernel
CJ Jackson
- [R] copy number estimation through oligo package?
Yupu Liang
- [R] histogram plot default
jim holtman
- [R] How to cut data elements included in a text line
Henrique Dallazuanna
- [R] How to cut data elements included in a text line
Jorge Ivan Velez
- [R] "Spreading risk" in a matrix
ACroske
- [R] using which to identify a range of values
sj
- [R] using which to identify a range of values
Henrique Dallazuanna
- [R] How to cut data elements included in a text line
Gabor Grothendieck
- [R] using which to identify a range of values
Sebastian P. Luque
- [R] Functions similar to step() and all.effects() that work for lme() objects?
Jon Zadra
- [R] "Spreading risk" in a matrix
ONKELINX, Thierry
- [R] Calculating Betweenness - Efficiency problem
Senthil Purushothaman
- [R] "Spreading risk" in a matrix
ACroske
- [R] using which to identify a range of values
Julian Burgos
- [R] system time - windows specific problem
Christophe Dutang
- [R] spreading the risk
markleeds at verizon.net
- [R] with lapply() how can you retrieve the name of the object
Andrew Yee
- [R] with lapply() how can you retrieve the name of the object
Jorge Ivan Velez
- [R] with lapply() how can you retrieve the name of the object
jim holtman
- [R] problem with putting text in outer margins (mtext outer=TRUE)
Janet Young
- [R] with lapply() how can you retrieve the name of the object
jim holtman
- [R] with lapply() how can you retrieve the name of the object
Jorge Ivan Velez
- [R] Retrieving data from a tcl /tk function
Judith Flores
- [R] How to solve systems of nonlinear equations in R?
François Aucoin
- [R] problem with putting text in outer margins (mtext outer=TRUE)
jim holtman
- [R] How to solve systems of nonlinear equations in R?
Stuart Nettleton
- [R] Graphics not working for R in ubuntu
Nataraj
- [R] R version 2.7.1 (warnings)
Van Wyk, Jaap
- [R] R version 2.7.1 (warnings)
Mark Difford
- [R] "Spreading risk" in a matrix
ONKELINX, Thierry
- [R] Graphics not working for R in ubuntu
Mose Andre
- [R] Graphics not working for R in ubuntu
Michael Bibo
- [R] t-test for multiple variables
Simon Anders
- [R] Title for graph with multiple plots
Tolga Uzuner
- [R] system time - windows specific problem
Duncan Murdoch
- [R] How to solve systems of nonlinear equations in R?
Berend Hasselman
- [R] Calculating Betweenness - Efficiency problem
jim holtman
- [R] system time - windows specific problem
Christophe Dutang
- [R] Discretize continous variables....
milicic.marko
- [R] initialize a factor vector
Johannes Huesing
- [R] Resshufling algorithm (Thiago Souza)
Thiago Souza
- [R] Discretize continous variables....
Frank E Harrell Jr
- [R] Graphics not working for R in ubuntu
Vincent Goulet
- [R] Discretize continous variables....
Daniel Malter
- [R] initialize a factor vector
Patrick Burns
- [R] fixed effect significance with lmer() vs. t-test
dej500 at york.ac.uk
- [R] Resshufling algorithm (Thiago Souza)
Bernardo Rangel Tura
- [R] Change font-face in title
Albin Blaschka
- [R] principal factor analysis
Jinsong Zhao
- [R] Change font-face in title
Gabor Grothendieck
- [R] Change font-face in title
jim holtman
- [R] Change font-face in title
Gabor Grothendieck
- [R] Discretize continous variables....
Frank E Harrell Jr
- [R] extracting colnames to label plots in a function
stephen sefick
- [R] Change font-face in title
Albin Blaschka
- [R] extracting colnames to label plots in a function
Gabor Grothendieck
- [R] extracting colnames to label plots in a function
stephen sefick
- [R] extracting colnames to label plots in a function
stephen sefick
- [R] initialize a factor vector
Patrick Burns
- [R] extracting colnames to label plots in a function
stephen sefick
- [R] extracting colnames to label plots in a function
Gabor Grothendieck
- [R] Title for graph with multiple plots
jim holtman
- [R] Title for graph with multiple plots
(Ted Harding)
- [R] Discretize continous variables....
Daniel Malter
- [R] Title for graph with multiple plots
Tolga Uzuner
- [R] Discretize continous variables....
Frank E Harrell Jr
- [R] Sweave add code \201
Christophe Genolini
- [R] replicate matrix blocks different numbers of times into new matrix
Ralph S.
- [R] Sweave add code \201
Peter Dalgaard
- [R] replicate matrix blocks different numbers of times into new matrix
Peter Dalgaard
- [R] wroung groupedData despite reading Bates and Pinheiro 3 times
hpdutra
- [R] wroung groupedData despite reading Bates and Pinheiro 3 times
milton ruser
- [R] wroung groupedData despite reading Bates and Pinheiro 3 times
hpdutra
- [R] estimating volume from xyz points
milton ruser
- [R] Likelihood ratio test between glm and glmer fits
Göran Broström
- [R] Calculating Betweenness - Efficiency problem
Senthil Purushothaman
- [R] Discretize continous variables....
milicic.marko
- [R] Non-linearly constrained optimisation
tolga.i.uzuner at jpmorgan.com
- [R] Discretize continous variables....
Johannes Huesing
- [R] Discretize continous variables....
Frank E Harrell Jr
- [R] Calculating Betweenness - Efficiency problem
jim holtman
- [R] replicate matrix blocks different numbers of times into new matrix
Ralph S.
- [R] replicate matrix blocks different numbers of times into new matrix
jim holtman
- [R] Discretize continous variables....
Frank E Harrell Jr
- [R] confusion matrix in randomForest
Miklos Kiss
- [R] Non-linearly constrained optimisation
Stuart Nettleton
- [R] Non-linearly constrained optimisation
Gabor Grothendieck
- [R] smooth.spline
rkevinburton at charter.net
- [R] smooth.spline
hadley wickham
- [R] replicate matrix blocks different numbers of times into new matrix
Ralph S.
- [R] problem with read.table
carol white
- [R] R version 2.7.1 (warnings)
Van Wyk, Jaap
- [R] Sweave add code \201
Christophe Genolini
- [R] R version 2.7.1 (warnings)
Mark Difford
- [R] Discretize continous variables....
Johannes Huesing
- [R] problem with read.table
carol white
- [R] estimating volume from xyz points
Gabor Grothendieck
- [R] R interprets symbol as q()
Roger Leenders
- [R] problem with read.table
jim holtman
- [R] R interprets symbol as q()
jim holtman
- [R] Parametric survival models with left truncated, right censored data
Göran Broström
- [R] Error in edit(name,file,title,editor)
David Epstein
- [R] Order of columns(variables) in dataframe
Daniel Wagner
- [R] Order of columns(variables) in dataframe
jim holtman
- [R] Error in edit(name,file,title,editor)
jim holtman
- [R] Order of columns(variables) in dataframe
Dimitris Rizopoulos
- [R] Order of columns(variables) in dataframe
(Ted Harding)
- [R] calculate differences - strange outcome
Bernardo Rangel Tura
- [R] Error in edit(name,file,title,editor)
David Epstein
- [R] drawing segments through points with pch=1
David Epstein
- [R] drawing segments through points with pch=1
Paul Smith
- [R] Discretize continous variables....
Frank E Harrell Jr
- [R] drawing segments through points with pch=1
Uwe Ligges
- [R] How do I install Joomla! 1.5?
Fido
- [R] Access to values of function arguments
willemf
- [R] drawing segments through points with pch=1
Prof Brian Ripley
- [R] drawing segments through points with pch=1
David Epstein
- [R] R interprets symbol as q()
Dieter Menne
- [R] smooth.spline
Spencer Graves
- [R] principal factor analysis
Hans W. Borchers
- [R] smooth.spline
Duncan Murdoch
- [R] smooth.spline
Spencer Graves
- [R] Access to values of function arguments
Prof Brian Ripley
- [R] Access to values of function arguments
Marc Schwartz
- [R] Indicator Kriging?
Sascha Bellaire
- [R] fill in area between 2 lines with a color
David Freedman
- [R] Conditionally Updating Lattice Plots
Bryan Hanson
- [R] Erro updating HTML package descriptions in packages.html
José Augusto Jr.
- [R] fill in area between 2 lines with a color
Dimitris Rizopoulos
- [R] fill in area between 2 lines with a color
Marc Schwartz
- [R] Conditionally Updating Lattice Plots
Gabor Grothendieck
- [R] Erro updating HTML package descriptions in packages.html
Uwe Ligges
- [R] Erro updating HTML package descriptions in packages.html
Gabor Grothendieck
- [R] Erro updating HTML package descriptions in packages.html
José Augusto Jr.
- [R] asp and ylim
David Epstein
- [R] Matching Up Values
Steve Murray
- [R] Erro updating HTML package descriptions in packages.html
Gabor Grothendieck
- [R] Access to values of function arguments
willemf
- [R] Off topic: SS formulae for 3-way repeated measure anova (for when aov() fails)
Mike Lawrence
- [R] Erro: cannot allocate vector of size 216.0 Mb
José Augusto Jr.
- [R] Non-linearly constrained optimisation
Hans W. Borchers
- [R] enumerate subsets
lamack lamack
- [R] Access to values of function arguments
jim holtman
- [R] asp and ylim
Rolf Turner
- [R] Erro: cannot allocate vector of size 216.0 Mb
jim holtman
- [R] enumerate subsets
jim holtman
- [R] enumerate subsets
Peter Dalgaard
- [R] enumerate subsets
Gabor Grothendieck
- [R] asp and ylim
David Epstein
- [R] asp and ylim
Gabor Grothendieck
- [R] asp and ylim
Prof Brian Ripley
- [R] asp and ylim
Paul Smith
- [R] Sum efficiently from large matrix according to re-occuring levels of factor?
Ralph S.
- [R] coin package (conditional inference / permutation): parameter teststat
Paulo Barata
- [R] Sum efficiently from large matrix according to re-occuring levels of factor?
hadley wickham
- [R] Sum efficiently from large matrix according to re-occuring levels of factor?
hadley wickham
- [R] Sum efficiently from large matrix according to re-occuring levels of factor?
Ralph S.
- [R] TeachingDemos question: my.symbols() alignment problems in complicated layout
Paul Murrell
- [R] TeachingDemos question: my.symbols() alignment problems in complicated layout
hadley wickham
- [R] smooth.spline
rkevinburton at charter.net
- [R] Lattice Version of grconvertX or variant on panel.text?
Bryan Hanson
- [R] Lattice Version of grconvertX or variant on panel.text?
hadley wickham
- [R] Sum efficiently from large matrix according to re-occuring levels of factor?
jim holtman
- [R] Lattice Version of grconvertX or variant on panel.text?
Bryan Hanson
- [R] Sum efficiently from large matrix according to re-occuring levels of factor?
Ralph S.
- [R] RODBC - problems using odbcDriverConnect without DSN
Josiah Walker
- [R] Lattice Version of grconvertX or variant on panel.text?
Gabor Grothendieck
- [R] CART and CHAID
Chua Siang Li
- [R] RODBC - problems using odbcDriverConnect without DSN
Prof Brian Ripley
- [R] CART and CHAID
Prof Brian Ripley
- [R] SVM: Graphical representation
M Perez
- [R] CART Analysis
Darin Brooks
- [R] CART Analysis
Tobias Verbeke
- [R] Erro: cannot allocate vector of size 216.0 Mb
Uwe Ligges
- [R] Erro: cannot allocate vector of size 216.0 Mb
Prof Brian Ripley
- [R] asp and ylim
David Epstein
- [R] Calculating Betweenness - Efficiency problem
Gabor Csardi
- [R] A question on the quandratic programming
Yunlei.Hu at barclayscapital.com
- [R] asp and ylim
David Epstein
- [R] sampling from a list of values while excluding one
Juliane Struve
- [R] CART and CHAID
Chua Siang Li
- [R] fama-macbeth
Denise Xifara
- [R] drawing segments through points with pch=1
Jim Lemon
- [R] sampling from a list of values while excluding one
jim holtman
- [R] sampling from a list of values while excluding one
Juliane Struve
- [R] fama-macbeth
Denise Xifara
- [R] asp and ylim
Martin Maechler
- [R] drawing segments through points with pch=1
Martin Maechler
- [R] CART and CHAID
Achim Zeileis
- [R] On creating grouped data set.
Dong-hyun Oh
- [R] help with integrate function
Brown, Andrew A
- [R] Erro: cannot allocate vector of size 216.0 Mb
José Augusto Jr.
- [R] par("din") vs dev.size()
Prof Brian Ripley
- [R] Time Series - Long Memory Estimation
Fotis Papailias
- [R] Time Series - Long Memory Estimation
Fotis Papailias
- [R] Getting plot axes where they should be!
(Ted Harding)
- [R] Getting plot axes where they should be!
Marc Schwartz
- [R] Getting plot axes where they should be!
Duncan Murdoch
- [R] Cross correlation significance test
Nora Hanson
- [R] Getting plot axes where they should be!
(Ted Harding)
- [R] Getting plot axes where they should be!
(Ted Harding)
- [R] drawing segments through points with pch=1
Paulo Barata
- [R] Cross correlation significance test
Nora Hanson
- [R] Howto Restart A Function with Try-Error Catch
Gundala Viswanath
- [R] Subsetting data by date
Williams, Robin
- [R] asp and ylim
David Epstein
- [R] asp and ylim
Martin Maechler
- [R] Subsetting data by date
Gabor Grothendieck
- [R] alternate usage of soil.texture (plotrix)
Dylan Beaudette
- [R] manipulate a matrix2
Jon Hak
- [R] TeachingDemos question: my.symbols() alignment problems in complicated layout
maria at meteo.mcgill.ca
- [R] Subsetting data by date
Gabor Grothendieck
- [R] Subsetting data by date
Williams, Robin
- [R] Subsetting data by date
Williams, Robin
- [R] Subsetting data by date
John Kane
- [R] Subsetting data by date
John Kane
- [R] avoid loop with three-dimensional array
Michela Cameletti
- [R] Subsetting data by date
Gabor Grothendieck
- [R] portfolio optimization problem - use R
fzp2008
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Michal Figurski
- [R] Avoid loop with three-dimensional array
Michela Cameletti
- [R] Creation of png=problems
Romain
- [R] How to solve systems of nonlinear equations in R?
Ravi Varadhan
- [R] manipulate a matrix2
jim holtman
- [R] xyplot: distance between axis and axis-label gets wrong
Sebastian Weber
- [R] On creating grouped data set.
jim holtman
- [R] dev2bitmap error, 'gs' cannot be found
Boel Brynedal
- [R] Mclust - which cluster is each observation in?
cnagy
- [R] Time Series - Long Memory Estimation
Fotis Papailias
- [R] manipulate a matrix2
Jon Hak
- [R] Parameter names in nls
rhelp.20.trevva at spamgourmet.com
- [R] Creation of png=problems
Richard Pearson
- [R] manipulate a matrix2
jim holtman
- [R] manipulate a matrix2
Jon Hak
- [R] dev2bitmap error, 'gs' cannot be found
Prof Brian Ripley
- [R] Output Nicely formatted tables from R
Bill Cunliffe
- [R] portfolio optimization problem - use R
José Augusto Jr.
- [R] TeachingDemos question: my.symbols() alignment problems in complicated layout
Greg Snow
- [R] Output Nicely formatted tables from R
Abhijit Dasgupta
- [R] lattice with bwplot
Roberts, Kyle
- [R] asp and ylim
Greg Snow
- [R] Editor fpr Mac OS
Angelo Scozzarella
- [R] Mclust - which cluster is each observation in?
Julian Burgos
- [R] Control parameter of the optim( ): parscale
Zornitsa Luleva
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Frank E Harrell Jr
- [R] vector help
Rajasekaramya
- [R] Editor fpr Mac OS
Hans W. Borchers
- [R] vector help
Jorge Ivan Velez
- [R] vector help
Henrique Dallazuanna
- [R] lattice with bwplot
Henrique Dallazuanna
- [R] Editor fpr Mac OS
Don MacQueen
- [R] vector help
Dimitris Rizopoulos
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Michal Figurski
- [R] optimize function help!!
emir.toktar at computer.org
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Doran, Harold
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
刘杰
- [R] Coefficients of Logistic Regression from bootstrap - how
(Ted Harding)
- [R] Editor fpr Mac OS
Rolf Turner
- [R] Parameter names in nls
Rolf Turner
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Doran, Harold
- [R] Howto Restart A Function with Try-Error Catch
Patrick Connolly
- [R] avoid loop with three-dimensional array
Charles C. Berry
- [R] Using integrate
Ayman Oweida
- [R] Table of tables?
Rolf Turner
- [R] Control parameter of the optim( ): parscale
Ben Bolker
- [R] y-axis number format on plot, barplot etc.
Bill Cunliffe
- [R] how to draw multiples curses (for given formulae) in lattice
John Smith
- [R] name returned by lapply
Tony Plate
- [R] Large number of dummy variables
Alan Spearot
- [R] Large number of dummy variables
Alan Spearot
- [R] Large number of dummy variables
Doran, Harold
- [R] Large number of dummy variables
Bert Gunter
- [R] Large number of dummy variables
Douglas Bates
- [R] Large number of dummy variables
Doran, Harold
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Frank E Harrell Jr
- [R] how to speed up this for loop?
Rheannon
- [R] Using integrate
Duncan Murdoch
- [R] experimental semivariogram
Alessandro
- [R] Conditionally Updating Lattice Plots
Deepayan Sarkar
- [R] confusion matrix in randomForest
Liaw, Andy
- [R] Lattice: How to draw curves from given formulae
John Smith
- [R] with lapply() how can you retrieve the name of the object
Andrew Yee
- [R] Sum efficiently from large matrix according to re-occuring levels of factor?
hadley wickham
- [R] Accessing individual variables from summary of lm
ascentnet
- [R] xyplot help
ae2356 at hotmail.com
- [R] Creation of png=problems
Prof Brian Ripley
- [R] Table orderd by frequencies
Kunzler, Andreas
- [R] determing font type in expression
Thomas Hoffmann
- [R] Urgent
Yunlei.Hu at barclayscapital.com
- [R] Parameter names in nls
rhelp.20.trevva at spamgourmet.com
- [R] Reading SPSS .por files
Jose Iparraguirre D'Elia
- [R] how to speed up this for loop?
bartjoosen
- [R] Table orderd by frequencies
Dimitris Rizopoulos
- [R] Table orderd by frequencies
Barry Rowlingson
- [R] xyplot help
Felix Andrews
- [R] scatter plot using ggplot
Megh Dal
- [R] determing font type in expression
Prof Brian Ripley
- [R] Accessing individual variables from summary of lm
Paul Smith
- [R] rpart$where and predict.rpart
Chua Siang Li
- [R] rpart$where and predict.rpart
Prof Brian Ripley
- [R] y-axis number format on plot, barplot etc.
Henrique Dallazuanna
- [R] randomForest Tutorial
Dirk Nemitz
- [R] alternate usage of soil.texture (plotrix)
Jim Lemon
- [R] Odp: how to speed up this for loop?
Petr PIKAL
- [R] Error in installing packages
Lazarus Mramba
- [R] loop for multiple regressions
Denise Xifara
- [R] Opening files from R terminal - appologies
Williams, Robin
- [R] randomForest Tutorial
Jim Porzak
- [R] Ignore previous emails
Williams, Robin
- [R] Opening files from R terminal - appologies
Gabor Grothendieck
- [R] Opening files from R terminal - appologies
Rossouw, Ruan (RF)
- [R] Opening files from R terminal - appologies
Sarah Goslee
- [R] How to filter a data frame?
rlearner309
- [R] normalised/transformed regressions
tolga.i.uzuner at jpmorgan.com
- [R] saving plot both as jpg and pdf
Monica Pisica
- [R] Opening files from R terminal - appologies
Prof Brian Ripley
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Michal Figurski
- [R] Does R have SQL interface in windows?
rlearner309
- [R] How to filter a data frame?
John Kane
- [R] Large number of dummy variables
Martin Maechler
- [R] How to filter a data frame?
Marc Schwartz
- [R] How to filter a data frame?
milton ruser
- [R] Parameter names in nls
Ben Bolker
- [R] Error in installing packages
Richard Pearson
- [R] How to filter a data frame?
Peter Dalgaard
- [R] How to filter a data frame?
John Kane
- [R] Error in installing packages
Ben Bolker
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Doran, Harold
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Michal Figurski
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Doran, Harold
- [R] Error in installing packages
Gabor Grothendieck
- [R] saving plot both as jpg and pdf
stephen sefick
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
N. Lapidus
- [R] How to filter a data frame?
Roland Rau
- [R] saving plot both as jpg and pdf
Greg Snow
- [R] saving plot both as jpg and pdf
Monica Pisica
- [R] saving plot both as jpg and pdf
Tomas Lanczos
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Bert Gunter
- [R] Does R have SQL interface in windows?
Gabor Grothendieck
- [R] normalised/transformed regressions
Greg Snow
- [R] how to speed up this for loop?
Rheannon
- [R] data transformation
Christian Hof
- [R] S4 : setGeneric for classical methods
cgenolin at u-paris10.fr
- [R] scatter plot using ggplot
hadley wickham
- [R] tklistbox and extracting selection to R
Judith Flores
- [R] normalised/transformed regressions
tolga.i.uzuner at jpmorgan.com
- [R] S4 : setGeneric for classical methods
Prof Brian Ripley
- [R] normalised/transformed regressions
Greg Snow
- [R] normalised/transformed regressions
tolga.i.uzuner at jpmorgan.com
- [R] S4 : setGeneric for classical methods
cgenolin at u-paris10.fr
- [R] Lattice: How to draw curves from given formulae
Deepayan Sarkar
- [R] Change font-face in title
Mike Prager
- [R] drawing segments through points with pch=1
Mike Prager
- [R] 2 Courses*** R/Splus Advanced Programming : August 14-15 in Seattle ! by XLSolutions Corp
sue at xlsolutions-corp.com
- [R] tklistbox and extracting selection to R
Greg Snow
- [R] Does R have SQL interface in windows?
Prof Brian Ripley
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Marc Schwartz
- [R] how to speed up this for loop?
Nordlund, Dan (DSHS/RDA)
- [R] randomForest Tutorial
Hans W. Borchers
- [R] data transformation
Marc Schwartz
- [R] Editor for Mac
Angelo Scozzarella
- [R] Help with rearranging data
William Pepe
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Doran, Harold
- [R] Help with rearranging data
Henrik Bengtsson
- [R] Help with rearranging data
jim holtman
- [R] Lattice: How to draw curves from given formulae
John Smith
- [R] Function Error
Angelo Scozzarella
- [R] Calculating Betweenness - Efficiency problem
Senthil Purushothaman
- [R] How to simulate heteroscedasticity (correlation)
Jörg Groß
- [R] rollmean and stl
stephen sefick
- [R] help on R benchmarks
Jiangtian Li
- [R] Function Error
Erik Iverson
- [R] how to speed up this for loop?
Nordlund, Dan (DSHS/RDA)
- [R] .asp (not really an R question) but related
stephen sefick
- [R] Function Error
Sarah Goslee
- [R] Help with rearranging data
William Pepe
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Michal Figurski
- [R] Function Error
Barry Rowlingson
- [R] help with simulate AR(1) data
cathelf
- [R] Function Error
anna freni sterrantino
- [R] Decoding subscripts/superscripts from CSVs
naw3 at duke.edu
- [R] Cannot re-start R after bus error
Ralph S.
- [R] Reading the data from specific columns
Vidhu Choudhary
- [R] Reading the data from specific columns
Henrique Dallazuanna
- [R] How to....
Jia Ying Mei
- [R] Lattice: How to draw curves from given formulae
Deepayan Sarkar
- [R] help with simulate AR(1) data
Rolf Turner
- [R] How to filter a data frame?
rlearner309
- [R] Decoding subscripts/superscripts from CSVs
Mark Difford
- [R] Cannot re-start R after bus error
Detlef Steuer
- [R] rollmean and stl
Achim Zeileis
- [R] Cannot re-start R after bus error
Ralph S.
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Frank E Harrell Jr
- [R] How to....
jim holtman
- [R] TextMate and R
Angelo Scozzarella
- [R] help with simulate AR(1) data
Peter Dalgaard
- [R] Change font-face in title
Gabor Grothendieck
- [R] Erro: cannot allocate vector of size 216.0 Mb
José Augusto Jr.
- [R] help with simulate AR(1) data
Rolf Turner
- [R] Erro: cannot allocate vector of size 216.0 Mb
Rolf Turner
- [R] F test
Vicki Meng
- [R] .asp (not really an R question) but related
Gabor Grothendieck
- [R] Erro: cannot allocate vector of size 216.0 Mb
José Augusto Jr.
- [R] Erro: cannot allocate vector of size 216.0 Mb
Rolf Turner
- [R] Plotting Multiple lines on one plot
R_Learner
- [R] F test
Peter Dalgaard
- [R] Editor for Mac
Shige Song
- [R] Plotting Multiple lines on one plot
RichardP
- [R] rpart confidence intervals?
RichardP
- [R] deblur microscope image stacks
Darren Weber
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Frank E Harrell Jr
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Rolf Turner
- [R] an extremely simple question
Edna Bell
- [R] average replicate probe values
Kaposi-Novak, Pal
- [R] select significant variables
闫梅
- [R] TextMate and R
Rob Goedman
- [R] an extremely simple question
milton ruser
- [R] scatter plot using ggplot
Megh Dal
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Michal J. Figurski
- [R] F test
Vicki Meng
- [R] rpart$where and predict.rpart
Chua Siang Li
- [R] Can't Load Text Files
Jia Ying Mei
- [R] Can't Load Text Files
milton ruser
- [R] Can't Load Text Files
Peter Alspach
- [R] rpart node number
Chua Siang Li
- [R] Accessing individual variables from summary of lm
ascentnet
- [R] adding the mean and standard deviation to boxplots
Fernando Marmolejo-Ramos
- [R] Accessing individual variables from summary of lm
Mark Difford
- [R] Accessing individual variables from summary of lm
Mark Difford
- [R] mle2(): logarithm of negative pdfs
Zornitsa Luleva
- [R] Editor for Mac
Hans-Peter Suter
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Mark Difford
- [R] mle2(): logarithm of negative pdfs
Patrizio Frederic
- [R] S4 : setGeneric for classical methods
Martin Maechler
- [R] Combining 4th column from 30 files
Daren Tan
- [R] scatter plot using ggplot
ONKELINX, Thierry
- [R] F test
Peter Dalgaard
- [R] experimental semivariogram
ONKELINX, Thierry
- [R] Indicator Kriging?
ONKELINX, Thierry
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Gustaf Rydevik
- [R] par() function does not work
Fabio Sanchez
- [R] rpart confidence intervals?
Richard Pearson
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Gustaf Rydevik
- [R] How to simulate heteroscedasticity (correlation)
Patrizio Frederic
- [R] maximum likelihood method to fit a model
Prof Brian Ripley
- [R] maximum likelihood method to fit a model
silvia narduzzi
- [R] maximum likelihood method to fit a model
Patrizio Frederic
- [R] Calculating Betweenness - Efficiency problem
Gabor Csardi
- [R] par() function does not work
Duncan Murdoch
- [R] par() function does not work
john seers (IFR)
- [R] maximum likelihood method to fit a model
Peter Dalgaard
- [R] How to....
Jim Lemon
- [R] par() function does not work
Peter Dalgaard
- [R] par() function does not work
Prof Brian Ripley
- [R] par() function does not work
john seers (IFR)
- [R] par() function does not work
Henrique Dallazuanna
- [R] average replicate probe values
jim holtman
- [R] adding the mean and standard deviation to boxplots
jim holtman
- [R] Combining 4th column from 30 files
Henrique Dallazuanna
- [R] R package
Prof Brian Ripley
- [R] Editor for Mac
stephen sefick
- [R] par() function does not work
Fabio Sanchez
- [R] Decoding subscripts/superscripts from CSVs
Jim Lemon
- [R] Simple... but...
Shubha Vishwanath Karanth
- [R] Time series reliability questions
John Theal
- [R] Quantitative analysis of non-standard scatter plots.
Firas Swidan
- [R] [Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?]
Michal Figurski
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Michal Figurski
- [R] Simple... but...
Doran, Harold
- [R] Simple... but...
Shubha Vishwanath Karanth
- [R] adding the mean and standard deviation to boxplots
John Kane
- [R] Simple... but...
Henrique Dallazuanna
- [R] Simple... but...
Shubha Vishwanath Karanth
- [R] Simple... but...
Nutter, Benjamin
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Johannes Huesing
- [R] Simple... but...
Doran, Harold
- [R] Convert list of lists <--> data frame
Michael Friendly
- [R] Simple... but...
Wacek Kusnierczyk
- [R] Simple... but...
ONKELINX, Thierry
- [R] Simple... but...
Jim Porzak
- [R] Simple... but...
Dimitris Rizopoulos
- [R] Simple... but...
(Ted Harding)
- [R] Simple... but...
Mitchell Maltenfort
- [R] Simple... but...
john seers (IFR)
- [R] Simple... but...
Doran, Harold
- [R] Simple... but...
Wacek Kusnierczyk
- [R] Using RODBC to use SQL queries
Albin Blaschka
- [R] Simple... but...
Berwin A Turlach
- [R] [Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?]
Gustaf Rydevik
- [R] Using RODBC to use SQL queries
Prof Brian Ripley
- [R] How to control the memory?
rlearner309
- [R] Simple... but...
Prof Brian Ripley
- [R] Simple... but...
Gabor Grothendieck
- [R] Simple... but...
Gustaf Rydevik
- [R] sequential sum of a vector...
Shubha Vishwanath Karanth
- [R] Simple... but...
Ben Bolker
- [R] Simple... but...
Wacek Kusnierczyk
- [R] Calling LISP programs in R
francogrex
- [R] Plotting Multiple lines on one plot
hadley wickham
- [R] Quantitative analysis of non-standard scatter plots.
Ben Bolker
- [R] How to....
Jia Ying Mei
- [R] RES: Simple... but...
Leandro Marino
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Gustaf Rydevik
- [R] Convert list of lists <--> data frame
Henrique Dallazuanna
- [R] Convert list of lists <--> data frame
Marc Schwartz
- [R] Convert list of lists <--> data frame
N. Lapidus
- [R] Simple... but...
Wacek Kusnierczyk
- [R] Simple... but...
Jorge Ivan Velez
- [R] Using RODBC to use SQL queries
Megan J Bellamy
- [R] Convert list of lists <--> data frame
Patrizio Frederic
- [R] Convert list of lists <--> data frame
Ben Bolker
- [R] sequential sum of a vector...
Jorge Ivan Velez
- [R] sequential sum of a vector...
Patrizio Frederic
- [R] sequential sum of a vector...
Shubha Vishwanath Karanth
- [R] sequential sum of a vector...
William Revelle
- [R] sequential sum of a vector...
Gustaf Rydevik
- [R] sequential sum of a vector...
Marc Schwartz
- [R] sequential sum of a vector...
Richard.Cotton at hsl.gov.uk
- [R] Using if, else statements
Robin Williams
- [R] sequential sum of a vector...
Henrique Dallazuanna
- [R] Quantitative analysis of non-standard scatter plots.
Bogaso Cristofer
- [R] Convert list of lists <--> data frame
Jorge Ivan Velez
- [R] Warning message in if else statement
Monica Pisica
- [R] Convert list of lists <--> data frame
Marc Schwartz
- [R] Convert list of lists <--> data frame
Henrique Dallazuanna
- [R] shQuote and cat
Vadim Organovich
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Michal Figurski
- [R] Flip Matrix form file?
Chris82
- [R] sequential sum of a vector...
denise xifaras
- [R] Using if, else statements
jim holtman
- [R] Using if, else statements
jim holtman
- [R] Using if, else statements
jim holtman
- [R] Using if, else statements
Patrick Burns
- [R] Warning message in if else statement
Erik Iverson
- [R] Using if, else statements
milton ruser
- [R] sum each row and output results
Rheannon
- [R] Using if, else statements
milton ruser
- [R] Quantitative analysis of non-standard scatter plots.
Firas Swidan, PhD
- [R] shQuote and cat
Duncan Murdoch
- [R] Flip Matrix form file?
Henrik Bengtsson
- [R] Warning message in if else statement
Monica Pisica
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Greg Snow
- [R] Quantitative analysis of non-standard scatter plots.
Daniel Folkinshteyn
- [R] Combining 4th column from 30 files
Henrik Bengtsson
- [R] Histogram
Angelo Scozzarella
- [R] Warning message in if else statement
Monica Pisica
- [R] Change font-face in title
Mike Prager
- [R] Histogram
milton ruser
- [R] Q re iterating a process and appending results to output file
Eric C Banfield
- [R] Questions on weighted least squares
Zhang Yanwei - Princeton-MRAm
- [R] Sample on dataframe
Jarekj
- [R] sum each row and output results
milton ruser
- [R] Sample on dataframe
milton ruser
- [R] Can't Load Text Files
Jia Ying Mei
- [R] Point-biserial correlation
Angelo Scozzarella
- [R] Using if, else statements
Gabriela Cendoya
- [R] Fw: Using if, else statements
Gabriela Cendoya
- [R] Sample on dataframe
Prof Brian Ripley
- [R] Histogram
Henrique Dallazuanna
- [R] Sample on dataframe
Jarekj
- [R] Questions on weighted least squares
Zhang Yanwei - Princeton-MRAm
- [R] sum each row and output results
Henrique Dallazuanna
- [R] Constrained coefficients in lm
Jorge Ivan Velez
- [R] Constrained coefficients in lm (correction)
Jorge Ivan Velez
- [R] Calling LISP programs in R
Steven McKinney
- [R] truncated normal
cindy Guo
- [R] pvclust
Eben Goodale
- [R] Using PrettyR to produce LaTeX output
jcarmichael
- [R] Questions on weighted least squares
Zhang Yanwei - Princeton-MRAm
- [R] Histogram
milton ruser
- [R] Q re iterating a process and appending results to output file
jim holtman
- [R] Q re iterating a process and appending results to output file
Eric C Banfield
- [R] truncated normal
Duncan Murdoch
- [R] Histogram
Mark Difford
- [R] Point-biserial correlation
Tobias Verbeke
- [R] Using PrettyR to produce LaTeX output
jcarmichael
- [R] truncated normal
Duncan Murdoch
- [R] Constrained coefficients in lm (correction)
Horace Tso
- [R] Using PrettyR to produce LaTeX output
Austin, Matt
- [R] Weighted variance function?
Arun Kumar Saha
- [R] Flip Matrix form file?
Chris82
- [R] FW: average replicate probe values
Kaposi-Novak, Pal
- [R] R2WinBUGS problem
Troels Ring
- [R] adding the mean and standard deviation to boxplots
HBaize
- [R] how can I write code to detect whether the machine is Windows or Linux?
Philip James Smith
- [R] Simulating multilevel responses
Elke Moons
- [R] how can I write code to detect whether the machine is Windows or Linux?
Rolf Turner
- [R] how can I write code to detect whether the machine is Windows or Linux?
Marc Schwartz
- [R] path and R CMD check
Christophe Genolini
- [R] Aggregating zoo object with NAs in multiple column
Abiel Reinhart
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Frank E Harrell Jr
- [R] Time series reliability questions
Achim Zeileis
- [R] an extremely simple question
Michael Kubovy
- [R] Constrained coefficients in lm (correction)
Moshe Olshansky
- [R] FW: average replicate probe values
jim holtman
- [R] Aggregating zoo object with NAs in multiple column
Achim Zeileis
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Gad Abraham
- [R] truncated normal
Duncan Murdoch
- [R] Using PrettyR to produce LaTeX output
Gabor Grothendieck
- [R] how can I write code to detect whether the machine is Windows or Linux?
Gabor Grothendieck
- [R] how to export ".xls" file with colorful cells?
XinMeng
- [R] Can R fill in missing values?
Jia Ying Mei
- [R] Can R fill in missing values?
Erik Iverson
- [R] Point-biserial correlation
William Revelle
- [R] Can R fill in missing values?
Gabor Grothendieck
- [R] Histogram
Vincent Goulet
- [R] convert a vector of words into a matrix
Daren Tan
- [R] truncated normal
Berwin A Turlach
- [R] ggplot question
Williams Scott
- [R] how can I write code to detect whether the machine is Windows or Linux?
Peter Dalgaard
- [R] lmer model with continuos non normal response variable, transformation needed?
Christoph Scherber
- [R] Functions similar to step() and all.effects() that work for lme() objects?
Christoph Scherber
- [R] convert a vector of words into a matrix
Patrick Burns
- [R] Functions similar to step() and all.effects() that work for lme() objects?
Prof Brian Ripley
- [R] time zone - best way to shift hours
DCC
- [R] convert a vector of words into a matrix
Daren Tan
- [R] convert a vector of words into a matrix
Wacek Kusnierczyk
- [R] Coconut benchmark for R?
Imanpreet
- [R] time zone - best way to shift hours
Prof Brian Ripley
- [R] How to get rule number in arules
Daniel Wagner
- [R] Is there an equivalent * operator?
Williams, Robin
- [R] unable to load a library
Gérard Henry
- [R] Is there an equivalent * operator?
Duncan Murdoch
- [R] Is there an equivalent * operator?
john seers (IFR)
- [R] Using PrettyR to produce LaTeX output
Jim Lemon
- [R] Bootstraping GAMs: confidence intervals
Luis Reino
- [R] Just 2 more questions - for now!
Williams, Robin
- [R] Problems with Rmpi and LAM 7.1.4
giuseppe1.milicia at hsbcib.com
- [R] convert a vector of words into a matrix
Wacek Kusnierczyk
- [R] convert a vector of words into a matrix
Henrique Dallazuanna
- [R] Interactive plot
Megh Dal
- [R] Just 2 more questions - for now!
stephen sefick
- [R] Problem with scatterplot3d example
Tom La Bone
- [R] NAs - NAs are not allowed in subscripted assignments
Kunzler, Andreas
- [R] Interactive plot
Duncan Murdoch
- [R] Just 2 more questions - for now!
Mark Difford
- [R] Just 2 more questions - for now!
Duncan Murdoch
- [R] Problem with scatterplot3d example
Duncan Murdoch
- [R] Interactive plot
Megh Dal
- [R] Just 2 more questions - for now!
john seers (IFR)
- [R] Interactive plot
Duncan Murdoch
- [R] Is there an equivalent * operator?
Felix Andrews
- [R] Is there an equivalent * operator?
René Capell
- [R] incrementing for loop by 2
Clark, Jennifer H
- [R] NAs - NAs are not allowed in subscripted assignments
Richard.Cotton at hsl.gov.uk
- [R] how to export ".xls" file with colorful cells?
Marc Schwartz
- [R] Multinomial logistic regression with non-numerical data.
TL Vincent
- [R] R2WinBUGS problem
Troels Ring
- [R] how know the status of particular process
Kurapati, Ravichandra (Ravichandra)
- [R] how to export ".xls" file with colorful cells?
Gabor Grothendieck
- [R] Dividing by 0
nmarti
- [R] Odp: sum each row and output results
Petr PIKAL
- [R] How to delete duplicate cases?
Daniel Wagner
- [R] Error - unable to load shared library
Youngik Yang
- [R] incrementing for loop by 2
Marc Schwartz
- [R] how know the status of particular process
Duncan Murdoch
- [R] incrementing for loop by 2
Wacek Kusnierczyk
- [R] How to delete duplicate cases?
Jorge Ivan Velez
- [R] How to delete duplicate cases?
Henrique Dallazuanna
- [R] How to delete duplicate cases?
Erik Iverson
- [R] incrementing for loop by 2
Dimitris Rizopoulos
- [R] Weighted variance function?
Gavin Simpson
- [R] How to delete duplicate cases?
Marc Schwartz
- [R] How to delete duplicate cases?
Patrizio Frederic
- [R] error with .dll file and RGtk2
paulandpen
- [R] NAs - NAs are not allowed in subscripted assignments
Kunzler, Andreas
- [R] [Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?]
Michal Figurski
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Michal Figurski
- [R] Problem with scatterplot3d example
Uwe Ligges
- [R] error with .dll file and RGtk2
Prof Brian Ripley
- [R] What is wrong with this contrast matrix?
Christoph Scherber
- [R] Help with which()
naw3 at duke.edu
- [R] Help with which()
Erik Iverson
- [R] NAs - NAs are not allowed in subscripted assignments
Gabor Csardi
- [R] ggplot question
hadley wickham
- [R] NAs - NAs are not allowed in subscripted assignments
Nordlund, Dan (DSHS/RDA)
- [R] What is wrong with this contrast matrix?
(Ted Harding)
- [R] What is wrong with this contrast matrix?
Christoph Scherber
- [R] Help with which()
Ben Bolker
- [R] NAs - NAs are not allowed in subscripted assignments
Nordlund, Dan (DSHS/RDA)
- [R] Help with which()
(Ted Harding)
- [R] Help with which()
Erik Iverson
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Bert Gunter
- [R] NAs - NAs are not allowed in subscripted assignments
Gabor Csardi
- [R] Formatting Syntax when Merging
Jia Ying Mei
- [R] Dividing by 0
Robert Baer
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Michal Figurski
- [R] Parallel Processing and Linear Regression
Alan Spearot
- [R] NAs - NAs are not allowed in subscripted assignments
Nordlund, Dan (DSHS/RDA)
- [R] Help with which()
Ben Bolker
- [R] R-package install
cindy Guo
- [R] How to get rule number in arules
Hans W. Borchers
- [R] Calculating Betweenness - Efficiency problem
Senthil Purushothaman
- [R] Problem with GLS dwtest function
mm745 at st-andrews.ac.uk
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Frank E Harrell Jr
- [R] [Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?]
Frank E Harrell Jr
- [R] Coconut benchmark for R?
Hans W. Borchers
- [R] NAs - NAs are not allowed in subscripted assignments
Gabor Csardi
- [R] factor question
Edna Bell
- [R] factor question
Henrique Dallazuanna
- [R] Question: how to build a subset to do separate calculations
Spencer
- [R] factor question
Mark Difford
- [R] ggplot2 help
Edna Bell
- [R] Dividing by 0
Rolf Turner
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
John Kane
- [R] Cairo graphics
Edna Bell
- [R] Subsetting an array by a vector of dimensions
Kenn Konstabel
- [R] SPR experiment: using lmer, transforming data, collinearity, and using a covariable
Claire Delle Luche
- [R] Cairo graphics
Philipp Pagel
- [R] Should this PDF render correctly without font embedding?
Jeffrey Horner
- [R] Question: how to build a subset to do separate calculations
Erik Iverson
- [R] R-package install
Mark Difford
- [R] Question: how to build a subset to do separate calculations
Erik Iverson
- [R] Question: how to build a subset to do separate calculations
stephen sefick
- [R] Question: how to build a subset to do separate calculations
stephen sefick
- [R] Should this PDF render correctly without font embedding?
stephen sefick
- [R] R-package install
cindy Guo
- [R] error with .dll file and RGtk2
Michael Lawrence
- [R] Should this PDF render correctly without font embedding?
Rolf Turner
- [R] Should this PDF render correctly without font embedding?
(Ted Harding)
- [R] sem & testing multiple hypotheses with BIC
John Fox
- [R] NAs - NAs are not allowed in subscripted assignments
Carl Witthoft
- [R] Interactive plot
David Scott
- [R] still more dumb questions
Edna Bell
- [R] still more dumb questions
Rolf Turner
- [R] Integrating R and Textmate
Arthur Roberts
- [R] Installing R packages in Textmate
Arthur Roberts
- [R] OT: course in research administration
Christopher W. Ryan
- [R] ANNOUNCE: rapache 1.1.0 release
Jeffrey Horner
- [R] Installing R packages in Textmate
Don MacQueen
- [R] simple random number generation
dxc13
- [R] ggplot2 help
David Freedman
- [R] How to preserve the numeric format and digits ?
Daren Tan
- [R] How to....
Jia Ying Mei
- [R] Rolling range and regression calculations
rcoder
- [R] How to preserve the numeric format and digits ?
milton ruser
- [R] Create an R package
FScottDahlgren
- [R] How to preserve the numeric format and digits ?
Austin, Matt
- [R] How to....
Jia Ying Mei
- [R] Relying on R to generate html tables with hyperlinks and pictures ?
Daren Tan
- [R] simple random number generation
jim holtman
- [R] simple random number generation
Moshe Olshansky
- [R] nlminb--lower bound for parameters are dependent on each others
Kyeongmi Cheon
- [R] simple random number generation
S Ellison
- [R] Bug in gap.plot
Arthur Roberts
- [R] simple random number generation
Rolf Turner
- [R] Installation error for RCurl in Redhat enterrpise 5
Momin, Amin A
- [R] Create an R package
Gabor Grothendieck
- [R] Fit a 3-Dimensional Line to Data Points
S. M. Niaz Arifin
- [R] problem in choosing cran mirror !
deepti nigam
- [R] R-package install
Prof Brian Ripley
- [R] Installation error for RCurl in Redhat enterrpise 5
Prof Brian Ripley
- [R] problem in choosing cran mirror !
Uwe Ligges
- [R] problem in choosing cran mirror !
Prof Brian Ripley
- [R] Bug in gap.plot
Uwe Ligges
- [R] Integrating R and Textmate
Uwe Ligges
- [R] Fit a 3-Dimensional Line to Data Points
Richard.Cotton at hsl.gov.uk
- [R] Error - unable to load shared library
Prof Brian Ripley
- [R] Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd
David Hajage
- [R] path and R CMD check
Uwe Ligges
- [R] discrete event simulation - "factory" with rework
seanpor
- [R] Help with rep
Van Wyk, Jaap
- [R] Help with rep
Peter Dalgaard
- [R] Help with rep
Gabor Csardi
- [R] Help with rep
Dimitris Rizopoulos
- [R] glht after lmer with "$S4class-" and "missing model.matrix-" errors
Anna Radtke
- [R] glht after lmer with "$S4class-" and "missing model.matrix-" errors with DATA
Anna Radtke
- [R] Three contrast matrices on the same linear model
Christoph Scherber
- [R] cannot allocate vector of size...
Uwe Ligges
- [R] Formatting Syntax when Merging
Gabor Grothendieck
- [R] Rolling range and regression calculations
Achim Zeileis
- [R] cannot allocate vector of size...
silvia narduzzi
- [R] Tutorial on rgl Graphics
Tom La Bone
- [R] Building a data frame with missing data
Natalia Quinteros
- [R] Bug in gap.plot
Jim Lemon
- [R] Relying on R to generate html tables with hyperlinks and pictures ?
Jim Lemon
- [R] Write lower half of distance matrix only
pgseye
- [R] Building a data frame with missing data
Henrique Dallazuanna
- [R] Dividing by 0
Jim Lemon
- [R] Fit a 3-Dimensional Line to Data Points
Prof Brian Ripley
- [R] Tutorial on rgl Graphics
Duncan Murdoch
- [R] Write lower half of distance matrix only
jim holtman
- [R] Matrix barplot
Andreas Tille
- [R] Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd
Frank E Harrell Jr
- [R] Matrix barplot
Nutter, Benjamin
- [R] Write lower half of distance matrix only
pgseye
- [R] path and R CMD check
Christophe Genolini
- [R] Rolling range and regression calculations
rcoder
- [R] pca
Alphonse Monkamg
- [R] Matrix barplot
Jim Lemon
- [R] Errror in running R2.7.1 version to R2.6.2 version
Lazarus Mramba
- [R] extracting Pr>ltl from robcov/ols (Design)
ldb
- [R] Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd
David Hajage
- [R] pca
Zhang Yanwei - Princeton-MRAm
- [R] Maximization under constraits
Daniela Garavaglia
- [R] Plink bed files
Federico Calboli
- [R] Matrix barplot
Andreas Tille
- [R] Rolling range and regression calculations
stephen sefick
- [R] Scatterplot matrix one column vs. the rest of the dataset
stephen sefick
- [R] glht after lmer with "$S4class-" and "missing model.matrix-" errors
Douglas Bates
- [R] Parallel Processing and Linear Regression
Martin Morgan
- [R] Matrix barplot
ajay ohri
- [R] S4 class and Package NAMESPACE [NC]
Sylvain ARCHENAULT
- [R] extracting Pr>ltl from robcov/ols (Design)
Mark Difford
- [R] Scatterplot matrix one column vs. the rest of the dataset
stephen sefick
- [R] Plink bed files
Robert Gentleman
- [R] "Multiple" Regressions indexed by goodness of fit
stephen sefick
- [R] Chi-square parameter estimation
Julio Rojas
- [R] Insert rows into a pre-existing data frame
naw3 at duke.edu
- [R] Saving a workspace with "extras"?
J.delasHeras at ed.ac.uk
- [R] Saving a workspace with "extras"?
Sarah Goslee
- [R] [R-pkgs] Package np version 0.20-0 released to CRAN
Jeffrey S. Racine
- [R] Saving a workspace with "extras"?
J.delasHeras at ed.ac.uk
- [R] melting a list: basic question
baptiste auguie
- [R] Insert rows into a pre-existing data frame
milton ruser
- [R] Tutorial on rgl Graphics
Tom La Bone
- [R] Integrating R and Textmate
Rob Goedman
- [R] Integrating R and Textmate
Hans-Jörg Bibiko
- [R] Fit a 3-Dimensional Line to Data Points
Hans W. Borchers
- [R] Tutorial on rgl Graphics
Duncan Murdoch
- [R] melting a list: basic question
Dieter Menne
- [R] Dividing by 0
nmarti
- [R] Interactive plot using playwith() and abline
Christoph Scherber
- [R] S4 class and Package NAMESPACE [NC]
Martin Morgan
- [R] plot zoo custom panel help
stephen sefick
- [R] Tutorial on rgl Graphics
Tom La Bone
- [R] Write lower half of distance matrix only
jim holtman
- [R] Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd
Frank E Harrell Jr
- [R] extracting Pr>ltl from robcov/ols (Design)
Frank E Harrell Jr
- [R] plot zoo custom panel help
Gabor Grothendieck
- [R] melting a list: basic question
baptiste auguie
- [R] Matrix barplot
Andreas Tille
- [R] Rolling range and regression calculations
rcoder
- [R] Maximization under constraits
Ben Bolker
- [R] plot zoo custom panel help
stephen sefick
- [R] R2WinBUGS problem
Uwe Ligges
- [R] Minor Bug in Documentation of merge()
Roland Rau
- [R] Tutorial on rgl Graphics
Duncan Murdoch
- [R] Minor Bug in Documentation of merge()
Duncan Murdoch
- [R] transcript a matlab code in R
Fotis Papailias
- [R] need help in parametric bootstrap
laila khalfan
- [R] create multi windows plot at the same time
Alessandro
- [R] create multi windows plot at the same time
ctu at bigred.unl.edu
- [R] Rolling range and regression calculations
stephen sefick
- [R] Rolling range and regression calculations
Gabor Grothendieck
- [R] transcript a matlab code in R
Berend Hasselman
- [R] create multi windows plot at the same time
stephen sefick
- [R] Percentile Estimation From Kernel Density Estimate
Jeffrey_Bromaghin at fws.gov
- [R] Dividing by 0
Roland Rau
- [R] Matrix barplot
Andreas Tille
- [R] Dividing by 0
Patrick Burns
- [R] Selecting the first measurement only from a longitudinal sequence
john james
- [R] plot zoo custom panel help
Gabor Grothendieck
- [R] s-plus in R... simpler code
Fotis Papailias
- [R] Pairs() function: selective changing of ylim; use of key
David Afshartous
- [R] graphing regression coefficients and standard errors
Murali K
- [R] R-pmg (poor man gui) question
Ferry
- [R] R: create multi windows plot at the same time
Alessandro
- [R] How to pass function argument of same name to internal call?
Carl Witthoft
- [R] plot zoo custom panel help
stephen sefick
- [R] Bug in gap.plot
Carl Witthoft
- [R] plot zoo custom panel help
Gabor Grothendieck
- [R] R: create multi windows plot at the same time
ctu at bigred.unl.edu
- [R] Numerical question
Zhang Yanwei - Princeton-MRAm
- [R] Error in vector("double", length)
Kumudan
- [R] Matrix from List
Nelson Villoria
- [R] Numerical question
stephen sefick
- [R] Installation error for RCurl in Redhat enterrpise 5
Momin, Amin A
- [R] Numerical question
(Ted Harding)
- [R] Thin frame line around R pdf output in LaTeX
Joseph Retzer
- [R] fit.dist gnlm question, NaN and Inf results
Richard and Barbara Males
- [R] How to pass function argument of same name to internal call?
Duncan Murdoch
- [R] Numerical question
Duncan Murdoch
- [R] R-package install
cindy Guo
- [R] parametric bootstrap
laila khalfan
- [R] 64-bit R on Mac OS X 10.4.5
joseph
- [R] parametric bootstrap
laila khalfan
- [R] 64-bit R on Mac OS X 10.4.5
Steven McKinney
- [R] melting a list: basic question
hadley wickham
- [R] melting a list: basic question
hadley wickham
- [R] Interactive plot using playwith() and abline
Felix Andrews
- [R] Matrix from List
jim holtman
- [R] Write lower half of distance matrix only
pgseye
- [R] Selecting the first measurement only from a longitudinal sequence
jim holtman
- [R] Help with matrix
Van Wyk, Jaap
- [R] Help with matrix
jim holtman
- [R] Simple vector question.
rkevinburton at charter.net
- [R] Simple vector question.
jim holtman
- [R] error in test
Paul Adams
- [R] error in test
jim holtman
- [R] Simple vector question.
rkevinburton at charter.net
- [R] R-package install
Prof Brian Ripley
- [R] Color of box frame in Legend (Was: Matrix barplot)
Andreas Tille
- [R] Thin frame line around R pdf output in LaTeX
Prof Brian Ripley
- [R] Write lower half of distance matrix only
Martin Maechler
- [R] parametric bootstrap
Prof Brian Ripley
- [R] Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd
David Hajage
- [R] Fw: how i can install Rgraphviz in R2.7.1
haani hanni
- [R] gam() of package "mgcv" and anova()
Kunio takezawa
- [R] melting a list: basic question
baptiste auguie
- [R] Help to Text Windoes in Menu with TCL-TK
ermimi
- [R] S4 : setGeneric for classical methods
cgenolin at u-paris10.fr
- [R] Fw: how i can install Rgraphviz in R2.7.1
Duncan Murdoch
- [R] S-PLUS code in R
Fotis Papailias
- [R] response surface analysis
Jinsong Zhao
- [R] S-PLUS code in R
Duncan Murdoch
- [R] S-PLUS code in R
Fotis Papailias
- [R] Simple vector question.
jim holtman
- [R] S-PLUS code in R
Fotis Papailias
- [R] competing risk model with time dependent covariates
phguardiol at aol.com
- [R] S4 : setGeneric for classical methods
Martin Maechler
- [R] R-package install
Uwe Ligges
- [R] S-PLUS code in R
Fotis Papailias
- [R] Fw: how i can install Rgraphviz in R2.7.1
Martin Morgan
- [R] response surface analysis
milton ruser
- [R] Remove non-numerical columns from data frame
Markus Mühlbacher
- [R] Remove non-numerical columns from data frame
Henrique Dallazuanna
- [R] Add a Vector to a Matrix
ascentnet
- [R] issues with gap.plot function
Zheng Lu
- [R] parametric bootstrap
laila khalfan
- [R] .Rprofile in RFrameworks?
Fredrik Lundgren
- [R] Marking Interval Length
Jia Ying Mei
- [R] Beginning lm
rkevinburton at charter.net
- [R] Can't get the correct order from melt.data.frame of reshape library.
Daren Tan
- [R] 64-bit R on Mac OS X 10.4.5
Matthew Keller
- [R] Remove non-numerical columns from data frame
Peter Dalgaard
- [R] Beginning lm
Mark Difford
- [R] Thin frame line around R pdf output in LaTeX
Joseph Retzer
- [R] Beginning lm
Marc Schwartz
- [R] question about cmprsk library
phguardiol at aol.com
- [R] Remove non-numerical columns from data frame
Henrik Bengtsson
- [R] Add a Vector to a Matrix
Marc Schwartz
- [R] issues with gap.plot function
Ben Bolker
- [R] Can't get the correct order from melt.data.frame of reshape library.
jim holtman
- [R] Marking Interval Length
jim holtman
- [R] GLS "no terms component" error
mm745 at st-andrews.ac.uk
- [R] Sample
Raphael Saldanha
- [R] Sample
jim holtman
- [R] Data length mismatch.
rkevinburton at charter.net
- [R] Sample
(Ted Harding)
- [R] Sample
Raphael Saldanha
- [R] Marking Interval Length
Jia Ying Mei
- [R] Spatial Sample
Raphael Saldanha
- [R] Data length mismatch.
Gabor Grothendieck
- [R] Marking Interval Length
jim holtman
- [R] Data length mismatch.
Gabor Grothendieck
- [R] [R-sig-Geo] Spatial Sample
Paul Hiemstra
- [R] Data length mismatch.
Gabor Grothendieck
- [R] Data length mismatch.
Gabor Grothendieck
- [R] Data length mismatch.
Gabor Grothendieck
- [R] Coarsening the Resolution of a Dataset
Steve Murray
- [R] Coarsening the Resolution of a Dataset
jim holtman
- [R] Dividing by 0
John Maindonald
- [R] Analyzing Intervals between Data
Jia Ying Mei
- [R] Analyzing Intervals between Data
jim holtman
- [R] Data length mismatch.
Don MacQueen
- [R] Analyzing Intervals between Data
Jia Ying Mei
- [R] Transfer Function Modeling
Ashish Kumar
- [R] GLS "no terms component" error
Bill.Venables at csiro.au
- [R] Analyzing Intervals between Data
jim holtman
- [R] Lattice wireframe: How to avoid drawing lines around polygons when using shade=TRUE
Oliver M. Haynold
- [R] Analyzing Intervals between Data
jim holtman
- [R] Complex to polar?
rkevinburton at charter.net
- [R] Complex to polar?
Prof Brian Ripley
- [R] S4 : setGeneric for classical methods
cgenolin at u-paris10.fr
- [R] Retain plot?
rkevinburton at charter.net
- [R] A easy way to write formula
Jinsong Zhao
- [R] Color of box frame in Legend (Was: Matrix barplot)
Andreas Tille
- [R] Weighted variance function?
Arun Kumar Saha
- [R] Lattice wireframe: How to avoid drawing lines around polygons when using shade=TRUE
Oliver M. Haynold
- [R] A easy way to write formula
ONKELINX, Thierry
- [R] Retain plot?
ONKELINX, Thierry
- [R] GLS "no terms component" error
mm745 at st-andrews.ac.uk
- [R] A easy way to write formula
Mark Difford
- [R] Weighted variance function?
Arun Kumar Saha
- [R] Weighted variance function?
Arun Kumar Saha
- [R] re sponse surface analysis
Tom La Bone
- [R] Object-oriented programming in R for Java programmers?
Werner Wernersen
- [R] response surface analysis
Jinsong Zhao
- [R] competing risk model with time dependent covariates under R or Splus
BXC (Bendix Carstensen)
- [R] [R-sig-Geo] Spatial Sample
Roger Bivand
- [R] equivalent R functions for Numerical Recipes fitxy and fitexy ?
Marc Fischer
- [R] Link functions in SEM
Jeroen Ooms
- [R] Colors in Sweave
Stephen Tucker
- [R] Object-oriented programming in R for Java programmers?
Johannes Huesing
- [R] melting a list: basic question
hadley wickham
- [R] Fitting a Bivariate Poisson log-normal distribution
Famoye, Felix
- [R] 64-bit R on Mac OS X 10.5.4
joseph
- [R] A easy way to write formula
hadley wickham
- [R] Object-oriented programming in R for Java programmers?
Jeroen Ooms
- [R] Object-oriented programming in R for Java programmers?
Stephen Tucker
- [R] Object-oriented programming in R for Java programmers?
Stephen Tucker
- [R] help with durbin.watson
tom soyer
- [R] product of successive rows
rcoder
- [R] Rolling regression - o/p selected coefficients
rcoder
- [R] graphing regression coefficients and standard errors
Ritwik Sinha
- [R] Maximization under constraits
Ritwik Sinha
- [R] Link functions in SEM
Stas Kolenikov
- [R] equivalent R functions for Numerical Recipes fitxy and fitexy ?
Marc Fischer
- [R] Interpolating a line and then summing there values for a diurnal oxygen curve (zoo object)
stephen sefick
- [R] Converting english words to numeric equivalents
oscar Linares
- [R] Interpolating a line and then summing there values for a diurnal oxygen curve (zoo object)
Gabor Grothendieck
- [R] Mixed model question.
Rolf Turner
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Tim Hesterberg
- [R] Converting english words to numeric equivalents
Rolf Turner
- [R] read.table question
Edna Bell
- [R] read.table question
Rolf Turner
- [R] Help with a loop
Sofia Martinez
- [R] Are there any packages that can process images other than pixelmap (i.e. pnm)?
Arthur Roberts
- [R] Are there any packages that can process images other than pixelmap (i.e. pnm)?
Henrik Bengtsson
- [R] How to set directory Rscript runs in/Sweave output directory
Paul.Rustomji at csiro.au
- [R] How to set directory Rscript runs in/Sweave output directory
Prof Brian Ripley
- [R] graphing regression coefficients and standard errors
Mark Difford
- [R] Transfer Function Modeling
Felix Andrews
- [R] Color of box frame in Legend (Was: Matrix barplot)
Andreas Tille
- [R] Help with a loop
Patrick Burns
- [R] I can not see help.start() in Ubuntu.
xiaopeng hu
- [R] Converting english words to numeric equivalents
Barry Rowlingson
- [R] Percentile Estimation From Kernel Density Estimate
Karl Ove Hufthammer
- [R] Converting english words to numeric equivalents
baptiste auguie
- [R] S4 : setGeneric for classical methods
Martin Maechler
- [R] Help with yaImpute
Wesley Roberts
- [R] Converting english words to numeric equivalents
(Ted Harding)
- [R] Converting english words to numeric equivalents
baptiste auguie
- [R] axis.break on Date-x-axis in lattice xyplot
Henning Wildhagen
- [R] Converting english words to numeric equivalents
Hans-Joerg Bibiko
- [R] Converting english words to numeric equivalents
Hans-Joerg Bibiko
- [R] Using stop ( ) from a Text Editor
Paulo Cardoso
- [R] axis.break on Date-x-axis in lattice xyplot
Ben Bolker
- [R] axis.break on Date-x-axis in lattice xyplot
Jim Lemon
- [R] Converting from char to POSIX:
Agustin Lobo
- [R] Using stop ( ) from a Text Editor
jim holtman
- [R] Using stop ( ) from a Text Editor
Prof Brian Ripley
- [R] [R-pkgs] randomSurvivalForest 3.5.0 now available
Udaya B. Kogalur
- [R] parametric bootstrap
laila khalfan
- [R] Using stop ( ) from a Text Editor
Paulo Cardoso
- [R] Rv: Chi-square parameter estimation
Julio Rojas
- [R] product of successive rows
jim holtman
- [R] Color of box frame in Legend (Was: Matrix barplot)
Nutter, Benjamin
- [R] speeding up loop and dealing wtih memory problems
Denise Xifara
- [R] how to add notes to the graph?
rlearner309
- [R] speeding up loop and dealing wtih memory problems
David Hajage
- [R] speeding up loop and dealing wtih memory problems
jim holtman
- [R] speeding up loop and dealing wtih memory problems
ONKELINX, Thierry
- [R] S4 : setGeneric for classical methods
cgenolin at u-paris10.fr
- [R] product of successive rows
Patrizio Frederic
- [R] speeding up loop and dealing wtih memory problems
Prof Brian Ripley
- [R] RODBC to query an Oracle table
Megan J Bellamy
- [R] writing the plots
Rajasekaramya
- [R] writing the plots
stephen sefick
- [R] how to export ".xls" file with colorful cells?
Kevin Wright
- [R] RODBC to query an Oracle table
Marc Schwartz
- [R] Bootstrapping
laila khalfan
- [R] how to add notes to the graph?
Dieter Menne
- [R] RStem with portuguese language
Paulo Cortez
- [R] multiv
Somesan, Ileana
- [R] Converting from char to POSIX:
Prof Brian Ripley
- [R] RODBC to query an Oracle table
Prof Brian Ripley
- [R] RODBC to query an Oracle table
Jim Porzak
- [R] Color of box frame in Legend (Was: Matrix barplot)
Prof Brian Ripley
- [R] in axis() suppressing axis line but keeping tick marks
Prof Brian Ripley
- [R] rollapply() opertation on ts matrix
rcoder
- [R] Overlay of simple plots
Phillip R. Hunt
- [R] Question about the SSOAP package
Aiste Aistike
- [R] Using PrettyR to produce LaTeX output
jcarmichael
- [R] Using PrettyR to produce LaTeX output
jcarmichael
- [R] Case statements in R
Wade Wall
- [R] Case statements in R
Henrik Bengtsson
- [R] Case statements in R
Roland Rau
- [R] Overlay of simple plots
stephen sefick
- [R] Case statements in R
David Katz
- [R] Case statements in R
Stefan Evert
- [R] Help with a loop
Sofia Martinez
- [R] Fill in NA values in vector with previous character/factor
Owen Jones
- [R] RStem with portuguese language
Duncan Temple Lang
- [R] Case statements in R
(Ted Harding)
- [R] Legality Question about R's Open Source GNU GPL License
zerfetzen
- [R] Negative Binomial Regression
jcarmichael
- [R] Case statements in R
Henrik Bengtsson
- [R] Is there way to multiple plots on gap.plot?
Arthur Roberts
- [R] Legality Question about R's Open Source GNU GPL License
Jim Porzak
- [R] Fill in NA values in vector with previous character/factor
Gabor Grothendieck
- [R] Fill in NA values in vector with previous character/factor
Dimitris Rizopoulos
- [R] Legality Question about R's Open Source GNU GPL License
Patrick Burns
- [R] Legality Question about R's Open Source GNU GPL License
Duncan Murdoch
- [R] Is there way to multiple plots on gap.plot?
Yasir Kaheil
- [R] Legality Question about R's Open Source GNU GPL License
Roland Rau
- [R] Legality Question about R's Open Source GNU GPL License
Marc Schwartz
- [R] Case statements in R
Patrick Burns
- [R] Fill in NA values in vector with previous character/factor
Yasir Kaheil
- [R] How to unsubscribe?
Endre Domiczi
- [R] How to unsubscribe?
Marc Schwartz
- [R] Legality Question about R's Open Source GNU GPL License
zerfetzen
- [R] Fill in NA values in vector with previous character/factor
Bert Gunter
- [R] loop does not work
aude Valade
- [R] loop does not work
Sarah Goslee
- [R] Fill in NA values in vector with previous character/factor
Christos Hatzis
- [R] rollapply() opertation on time series
rcoder
- [R] multiv
Mark Difford
- [R] [-->OT] was: Re: Legality Question about R's Open Source GNU GPL License
(Ted Harding)
- [R] RODBC to query an Oracle table
David Scott
- [R] Link functions in SEM
John Fox
- [R] help with durbin.watson
John Fox
- [R] Mixed model question.
Douglas Bates
- [R] Rf_error crashes entire program.
Andrew Redd
- [R] rollapply() opertation on time series
Gabor Grothendieck
- [R] Is there a way to avoid loading dependendent packages?
Paul.Rustomji at csiro.au
- [R] Rf_error crashes entire program.
Duncan Murdoch
- [R] rollapply() opertation on time series
Gabor Grothendieck
- [R] Mixed model question.
Rolf Turner
- [R] Is there a way to avoid loading dependendent packages?
Duncan Murdoch
- [R] Is there a way to avoid loading dependendent packages?
Henrik Bengtsson
- [R] 64-bit R on Mac OS X 10.5.4
joseph
- [R] "wave model" semivariogram
Alessandro
- [R] Rf_error crashes entire program.
Andrew Redd
- [R] environment question
Edna Bell
- [R] environment question
Jeffrey Horner
- [R] Help interpreting density().
rkevinburton at charter.net
- [R] Is there anyway to clip the bottom of a barplot?
Arthur Roberts
- [R] Is there anyway to clip the bottom of a barplot?
hadley wickham
- [R] list
Paul Adams
- [R] Help interpreting density().
Bill.Venables at csiro.au
- [R] Help interpreting density().
Mark Difford
- [R] Rf_error crashes entire program.
Prof Brian Ripley
- [R] How to set the parameters in Trellis Graphics (by Lattice package)
G.H. Zuo
- [R] product of successive rows
Moshe Olshansky
- [R] Help interpreting density().
rkevinburton at charter.net
- [R] Help interpreting density().
rkevinburton at charter.net
- [R] Help interpreting density().
Mark Difford
- [R] Help interpreting density().
rkevinburton at charter.net
- [R] Help interpreting density().
Mark Difford
- [R] Problem reading a particular file with read.spss()
Chuck Cleland
- [R] how to add notes to the graph?
Jim Lemon
- [R] Is there way to multiple plots on gap.plot?
Jim Lemon
- [R] keywords
Edna Bell
- [R] Bug in sd() and var() in handling vectors of NA (R version 2.7.1)?
Marisa Laetitia
- [R] list
jim holtman
- [R] FW: Installing BRugs
BXC (Bendix Carstensen)
- [R] Problem reading a particular file with read.spss()
Prof Brian Ripley
- [R] max
Paul Adams
- [R] FW: Installing BRugs
Uwe Ligges
- [R] product of successive rows
Jorge Ivan Velez
- [R] mac install no font found problem in quartz display
Zhesi He
- [R] Panel of pie charts
Amin Momin
- [R] stringdot ?
renata.camargo05 at ntlworld.com
- [R] optim fails when using arima
MAIDER MATEOS DEL PINO
- [R] 'for' loop, two variables
Oehler, Friderike (AGPP)
- [R] Is there way to multiple plots on gap.plot?
Jim Lemon
- [R] 'for' loop, two variables
Duncan Murdoch
- [R] 'for' loop, two variables
ONKELINX, Thierry
- [R] 'for' loop, two variables
Benno Pütz
- [R] FW: Installing BRugs
Prof Brian Ripley
- [R] Bug in sd() and var() in handling vectors of NA (R version 2.7.1)?
Prof Brian Ripley
- [R] Negative Binomial Regression
Ben Bolker
- [R] How to set the parameters in Trellis Graphics (by Lattice package)
Felix Andrews
- [R] combining zoo series with an overlapping index?
stephen sefick
- [R] keywords
Charilaos Skiadas
- [R] combining zoo series with an overlapping index?
Gabor Grothendieck
- [R] Panel of pie charts
John Kane
- [R] combining zoo series with an overlapping index?
stephen sefick
- [R] writing the plots
John Kane
- [R] Howto Draw Bimodal Gamma Curve with User Supplied Parameters
Gundala Viswanath
- [R] About clustering techniques
pacomet
- [R] Coarsening the Resolution of a Dataset
Steve Murray
- [R] About clustering techniques
ctu at bigred.unl.edu
- [R] About clustering techniques
Christian Hennig
- [R] combining zoo series with an overlapping index?
Gabor Grothendieck
- [R] About clustering techniques
Christian Hennig
- [R] Most often pairs of chars across grouping variable
svga at arcor.de
- [R] Negative Binomial Regression
Prof Brian Ripley
- [R] Most often pairs of chars across grouping variable
Marc Schwartz
- [R] Case statements in R
Roland Rau
- [R] subscript out of bounds error.
Rajasekaramya
- [R] biplot_group_colours_and_point_symbols
Indermaur Lukas
- [R] lattice question
Troels Ring
- [R] subscript out of bounds help
Rajasekaramya
- [R] Removing script file
Dennis Fisher
- [R] tensor product of equi-spaced B-splines in the unit square
Patrizio Frederic
- [R] Bootstraping GAMs for confidence intervales calculation
Luis Reino
- [R] Negative Binomial Regression
Ben Bolker
- [R] more environment questions
Edna Bell
- [R] Panel of pie charts
Richard.Cotton at hsl.gov.uk
- [R] more environment questions
Gabor Grothendieck
- [R] Question regarding statisticians
Max
- [R] table questions
Edna Bell
- [R] more environment questions
Edna Bell
- [R] more environment questions
Gabor Grothendieck
- [R] ls() and memory question
Edna Bell
- [R] Graphics function question
Peter Flom
- [R] combining zoo series with an overlapping index?
stephen sefick
- [R] try question
Edna Bell
- [R] accessing list elements
Paul Adams
- [R] Removing script file
Prof Brian Ripley
- [R] try question
Richard.Cotton at hsl.gov.uk
- [R] Panel of pie charts
Gavin Simpson
- [R] Graphics function question
Marc Schwartz
- [R] Negative Binomial Regression
Prof Brian Ripley
- [R] Graphics function question
Sarah Goslee
- [R] accessing list elements
Sarah Goslee
- [R] try question
Prof Brian Ripley
- [R] Negative Binomial Regression
Ben Bolker
- [R] Major Cloud Computing Testbed Announced at University of Illinois
Ajay ohri
- [R] Graphics function question
Sarah Goslee
- [R] accessing list elements
Erik Iverson
- [R] List names help
Rajasekaramya
- [R] Flexible semivariogram in R (HELP)
Alessandro
- [R] finding a faster way to do an iterative computation
dxc13
- [R] table questions
Patrizio Frederic
- [R] List names help
Sarah Goslee
- [R] combining zoo series with an overlapping index?
stephen sefick
- [R] Graphics function question
Marc Schwartz
- [R] Legality Question about R's Open Source GNU GPL License
David Henderson
- [R] ls() and memory question
jim holtman
- [R] R command history -- can it be like Matlab's?
losemind
- [R] Coarsening the Resolution of a Dataset
jim holtman
- [R] optimize simultaneously two binomials inequalities using nlm
emir.toktar at gmail.com
- [R] R command history -- can it be like Matlab's?
Prof Brian Ripley
- [R] try question
Mike Prager
- [R] finding a faster way to do an iterative computation
Rolf Turner
- [R] finding a faster way to do an iterative computation
Christos Hatzis
- [R] R command history -- can it be like Matlab's?
hadley wickham
- [R] R command history -- can it be like Matlab's?
Rolf Turner
- [R] rollapply() opertation on time series
rcoder
- [R] correlation between matrices - both with some NAs
rcoder
- [R] R command history -- can it be like Matlab's?
hadley wickham
- [R] placing a text in the corner of a plot
Jörg Groß
- [R] placing a text in the corner of a plot
Jorge Ivan Velez
- [R] rolling regression between adjacent columns
rcoder
- [R] Is there a better way to check if an element of a list exists than using match on names?
Paul.Rustomji at csiro.au
- [R] finding a faster way to do an iterative computation
Moshe Olshansky
- [R] R command history -- can it be like Matlab's?
losemind
- [R] What's the best way to operate R from within Excel?
losemind
- [R] placing a text in the corner of a plot
Jörg Groß
- [R] Help interpreting density().
Bill.Venables at csiro.au
- [R] Chi-square parameter estimation
Moshe Olshansky
- [R] placing a text in the corner of a plot
Rolf Turner
- [R] placing a text in the corner of a plot
Ben Tupper
- [R] finding a faster way to do an iterative computation
dxc13
- [R] Legality Question about R's Open Source GNU GPL License
Gad Abraham
- [R] Colors in Sweave
Duncan Murdoch
- [R] Legality Question about R's Open Source GNU GPL License
Gad Abraham
- [R] Legality Question about R's Open Source GNU GPL License
David Henderson
- [R] table questions
(Ted Harding)
- [R] Legality Question about R's Open Source GNU GPL License
Charles Annis, P.E.
- [R] table questions
(Ted Harding)
- [R] how to get the position of a vector-value
Jörg Groß
- [R] rollapply() opertation on time series
Gabor Grothendieck
- [R] rolling regression between adjacent columns
Gabor Grothendieck
- [R] how to get the position of a vector-value
Katharine Mullen
- [R] how to get the position of a vector-value
jim holtman
- [R] Is there a better way to check if an element of a list exists than using match on names?
jim holtman
- [R] R command history -- can it be like Matlab's?
Spencer Graves
- [R] Repeated Measure ANOVA-Old question
ctu at bigred.unl.edu
- [R] Re peated Measure ANOVA-Old question
Mark Difford
- [R] Urgent
Moshe Olshansky
- [R] Re peated Measure ANOVA-Old question
ctu at bigred.unl.edu
- [R] R command history -- can it be like Matlab's?
Martin Maechler
- [R] What's the best way to operate R from within Excel?
Patrizio Frederic
- [R] ~ . help
renata.camargo05 at ntlworld.com
- [R] problem with nested loops
Jens Oldeland
- [R] Re peated Measure ANOVA-Old question
Mark Difford
- [R] Coarsening the Resolution of a Dataset
Steve Murray
- [R] Coarsening the Resolution of a Dataset
Steve Murray
- [R] Successfully connected GNU R to PostgreSQL on windows XP.
Andre Cesta
- [R] Eclipse/Statet: How to set breakpoints
el_eli at gmx.de
- [R] R command history -- can it be like Matlab's?
Gad Abraham
- [R] need some help
Kurapati, Ravichandra (Ravichandra)
- [R] Howto Draw Bimodal Gamma Curve with User Supplied Parameters
Patrizio Frederic
- [R] Need help
renata.camargo05 at ntlworld.com
- [R] R command history -- can it be like Matlab's?
bartjoosen
- [R] Need help
Richard.Cotton at hsl.gov.uk
- [R] Re peated Measure ANOVA-Old question
Gavin Simpson
- [R] problem with read.table()
Birgitle
- [R] R GUI help
Tom.O
- [R] Coarsening the Resolution of a Dataset
jim holtman
- [R] problem with nested loops
Kenn Konstabel
- [R] need some help
jim holtman
- [R] read XML
Paulo Cardoso
- [R] function to transform response of a formula
Paul Emberson
- [R] problem with read.table()
Philipp Pagel
- [R] Bizarre - R crashes on merge
Williams, Robin
- [R] problem with read.table()
Birgitle
- [R] Need help
Prof Brian Ripley
- [R] Need help
Prof Brian Ripley
- [R] function to transform response of a formula
email at calidasoft.co.uk
- [R] Eclipse/Statet: How to set breakpoints
Duncan Murdoch
- [R] Bizarre - R crashes on merge
Philipp Pagel
- [R] table questions
Jim Lemon
- [R] Bizarre - R crashes on merge
Philipp Pagel
- [R] glm error: factor levels
Birgitle
- [R] png() does not generate a 24 bit PNG file
Fán Lóng
- [R] adding lines to multiple plots
Gary W
- [R] Mixed effects model where nested factor is not the repeated across treatments lme???
M Ensbey
- [R] FFT - (STATS) - is this correct?
renata.camargo05 at ntlworld.com
- [R] placing a text in the corner of a plot
Jim Lemon
- [R] Eclipse/Statet: How to set breakpoints
Duncan Murdoch
- [R] Re creating Procrustes Plot in Lattice
Andrewjohnclose
- [R] "dens" function
Shubha Vishwanath Karanth
- [R] Connecting R to PostgreSQL on Windows.
Andre Cesta
- [R] read XML
Martin Morgan
- [R] function to transform response of a formula
Paul Emberson
- [R] What's the best way to operate R from within Excel?
losemind
- [R] adding lines to multiple plot
Gary W
- [R] R command history -- can it be like Matlab's?
losemind
- [R] R -Legality Question about R's Open Source GNU GPL License
Ajay ohri
- [R] Unexpected line type in lattice plot key on pdf device
G. Draisma
- [R] read XML
Paulo Cardoso
- [R] odds ratios in multiway tables (stratified)
Wim Bertels
- [R] R -Legality Question about R's Open Source GNU GPL License
Stevens, Martin Henry H. Dr.
- [R] model mix problem. FALSE CONVERGENCE
mergullo
- [R] FFT - (STATS) - is this correct?
stephen sefick
- [R] adding lines to multiple plot
Ben Bolker
- [R] R -Legality Question about R's Open Source GNU GPL License
Marc Schwartz
- [R] adding lines to multiple plot
Gary W
- [R] Most often pairs of chars across grouping variable
svga at arcor.de
- [R] R -Legality Question about R's Open Source GNU GPL License
Marc Schwartz
- [R] R -Legality Question about R's Open Source GNU GPL License
Roland Rau
- [R] Rprintf will not build in my C++ compiler
nmarti
- [R] adding lines to multiple plot
Ben Bolker
- [R] Percent Change After Each Interval
Jia Ying Mei
- [R] R -Legality Question about R's Open Source GNU GPL License
ohri2007 at gmail.com
- [R] Mixed effects model where nested factor is not the repeated across treatments lme???
ctu at bigred.unl.edu
- [R] R -Legality Question about R's Open Source GNU GPL License
Marc Schwartz
- [R] Axes in perspective plot - persp()
David Afshartous
- [R] Rprintf will not build in my C++ compiler
Prof Brian Ripley
- [R] R -Legality Question about R's Open Source GNU GPL Licen
(Ted Harding)
- [R] R -Legality Question about R's Open Source GNU GPL License
ohri2007 at gmail.com
- [R] FOURIER TRANSFORM HELP
renata.camargo05 at ntlworld.com
- [R] R -Legality Question about R's Open Source GNU GPL Licen
Csardi Gabor
- [R] Re creating Procrustes Plot in Lattice
Gavin Simpson
- [R] ~ . help
Michael Dewey
- [R] OT: Data mining on demand .Using cloud computers.
Ajay ohri
- [R] bug in 'margins' behavior in reshape - cast
mfrumin
- [R] Hello,
Kiran Annaiah
- [R] R -Legality Question about R's Open Source GNU GPL License
Gavin Simpson
- [R] R -Legality Question about R's Open Source GNU GPL License
Gavin Simpson
- [R] bug in 'margins' behavior in reshape - cast
hadley wickham
- [R] best quad core configuration?
Alan Swanson
- [R] odds ratios in multiway tables (stratified)
Marc Schwartz
- [R] Mixed effects model where nested factor is not the repeated across treatments lme???
Mark Difford
- [R] Variable name in a String
R_Learner
- [R] Re creating Procrustes Plot in Lattice
Dylan Beaudette
- [R] bug in 'margins' behavior in reshape - cast
mfrumin
- [R] About clustering techniques
pacomet
- [R] best quad core configuration?
Vincent Goulet
- [R] setting editor environment variable EDITOR either when configuring R for installation or in .Rprofile
Mark Kimpel
- [R] Re gression between columns in matrix - with some/full NAs
rcoder
- [R] setting editor environment variable EDITOR either when configuring R for installation or in .Rprofile
Marc Schwartz
- [R] rolling regression between adjacent columns
rcoder
- [R] bug in 'margins' behavior in reshape - cast
hadley wickham
- [R] History pruning
Ken Williams
- [R] Random subset
Alessandro
- [R] Random subset
John Kane
- [R] Random subset
Roland Rau
- [R] System exit codes
Ranjan Bagchi
- [R] john chambers R book
markleeds at verizon.net
- [R] Random subset
Marc Schwartz
- [R] Random subset
Marc Schwartz
- [R] System exit codes
Ranjan Bagchi
- [R] setting editor environment variable EDITOR either when configuring R for installation or in .Rprofile
Prof Brian Ripley
- [R] Variable name in a String
Erik Iverson
- [R] Random subset
Roland Rau
- [R] History pruning
Marc Schwartz
- [R] rolling regression between adjacent columns
Gabor Grothendieck
- [R] Setting fixed size for segement plot using stars() (axes size vs print size)
Jay Douillard
- [R] Re creating Procrustes Plot in Lattice
Gavin Simpson
- [R] System exit codes
Prof Brian Ripley
- [R] read XML
Martin Morgan
- [R] System exit codes
Ranjan Bagchi
- [R] Converting to subscripts and superscripts
naw3 at duke.edu
- [R] john chambers R book
Christos Hatzis
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Michal Figurski
- [R] john chambers R book
Marc Schwartz
- [R] Rprintf will not build in my C++ compiler
nmarti
- [R] FFT - (STATS) - is this correct?
Rolf Turner
- [R] setting editor environment variable EDITOR either when configuring R for installation or in .Rprofile
Mark Kimpel
- [R] Sampling two exponentials
Zhang Yanwei - Princeton-MRAm
- [R] Re gression between adjacent columns - error with NAs
rcoder
- [R] john chambers R book
stephen sefick
- [R] barplot for a categorial variable
kayj
- [R] question about krige code in R
Alessandro
- [R] dotFirst option
Ferry
- [R] dotFirst option
Rolf Turner
- [R] Lattice wireframe: How to avoid drawing lines around polygons when using shade=TRUE
Deepayan Sarkar
- [R] Unexpected line type in lattice plot key on pdf device
Deepayan Sarkar
- [R] barplot for a categorial variable
Bill.Venables at csiro.au
- [R] Is conditional evaluation of R code chunks possible in Sweave ?
Paul.Rustomji at csiro.au
- [R] Sampling two exponentials
Ben Bolker
- [R] curva PI
Bruno P Masi
- [R] Re gression between adjacent columns - error with NAs
Krzysztof Sakrejda-Leavitt
- [R] High resolution graphics from Windows Vista
Adam Langley
- [R] Re gression between adjacent columns - error with NAs
Gabor Grothendieck
- [R] Sampling two exponentials
Moshe Olshansky
- [R] colnames from read.table
Chua Siang Li
- [R] S 3 generic method consistency warning please help
stephen sefick
- [R] S 3 generic method consistency warning please help
Gabor Grothendieck
- [R] S 3 generic method consistency warning please help
stephen sefick
- [R] S 3 generic method consistency warning please help
stephen sefick
- [R] colnames from read.table
Erik Iverson
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Frank E Harrell Jr
- [R] predict rpart: new data has new level
Chua Siang Li
- [R] multiple separators in scan() functions
milton ruser
- [R] Rearranging Data
Jia Ying Mei
- [R] Generic plot function for GLM objects
Beat Huggler
- [R] High resolution graphics from R Windows Vista
Adam Langley
- [R] stats question
Iasonas Lamprianou
- [R] predict rpart: new data has new level
Prof Brian Ripley
- [R] High resolution graphics from R Windows Vista
Prof Brian Ripley
- [R] multiple separators in scan() functions
Prof Brian Ripley
- [R] stats question
Moshe Olshansky
- [R] add string
Alfredo Alessandrini
- [R] add string
john seers (IFR)
- [R] combinations with replications
MarinaTarantini
- [R] random effects mixed model, different regressors
Fensis
- [R] bug in 'margins' behavior in reshape - cast
Michael Frumin
- [R] OT:Selling Data Mining Cloud-A Concept
Ajay ohri
- [R] Identifying common prefixes from a vector of words, and delete those prefixes
Daren Tan
- [R] combinations with replications
Jim Lemon
- [R] Location of HTML help files
Keith Ponting
- [R] combinations with replications
ONKELINX, Thierry
- [R] nls weights warning message
Lisa Readdy
- [R] odds ratios in multiway tables (stratified)
Wim Bertels
- [R] bug in 'margins' behavior in reshape - cast
hadley wickham
- [R] Sampling two exponentials
Zhang Yanwei - Princeton-MRAm
- [R] bug in 'margins' behavior in reshape - cast
mfrumin
- [R] stats question
Marc Schwartz
- [R] nls weights warning message
Prof Brian Ripley
- [R] Sampling two exponentials
Ben Bolker
- [R] nls weights warning message
Prof Brian Ripley
- [R] Identifying common prefixes from a vector of words, and delete those prefixes
Richard.Cotton at hsl.gov.uk
- [R] equivalent R functions for Numerical Recipes fitxy and fitexy ?
Liaw, Andy
- [R] History pruning
Ken Williams
- [R] Significance of confidence intervals in the Non-Linear Least Squares Program.
bbouling
- [R] Converting to subscripts and superscripts
Ben Bolker
- [R] Identifying Points That Belongs to Components of Mixture Models
Gundala Viswanath
- [R] Rearranging Data
Jia Ying Mei
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Michal Figurski
- [R] stats question
Iasonas Lamprianou
- [R] tensor product of equi-spaced B-splines in the unit square
Patrizio Frederic
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Gustaf Rydevik
- [R] odds ratios in multiway tables (stratified)
Marc Schwartz
- [R] Create an R package
FScottDahlgren
- [R] History pruning
Marc Schwartz
- [R] Code to calculate internal rate of return
Thomas E
- [R] Sperman Correlation with rcorr (Hmisc)
Birgitle
- [R] question about krige code in R
Roger Bivand
- [R] Identifying common prefixes from a vector of words, and delete those prefixes
John Kane
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Mark Difford
- [R] [R-pkgs] hwriter - Writing R objects in HTML format
Gregoire Pau
- [R] Identifying common prefixes from a vector of words, and delete those prefixes
Christos Hatzis
- [R] Random number generation
Max
- [R] Random number generation
David Barron
- [R] Random number generation
Marc Schwartz
- [R] Coefficients of Logistic Regression from bootstrap - how to get them?
Michal Figurski
- [R] Sampling two exponentials
Zhang Yanwei - Princeton-MRAm
- [R] Random number generation
Jorge Ivan Velez
- [R] Random number generation
Patrizio Frederic
- [R] Random number generation
Max
- [R] History pruning
Ken Williams
- [R] anisotrophy in fit.variogram problem
Alessandro
- [R] Re gression between adjacent columns - error with NAs
rcoder
- [R] How to output R image to a file?
Aiste Aistike
- [R] How to output R image to a file?
Erik Iverson
- [R] Random number generation
Max
- [R] How to output R image to a file?
Aiste Aistike
- [R] History pruning
Duncan Murdoch
- [R] reference in article
Peter Dalgaard
- [R] Query about finding correlations
Stefan Grosse
- [R] rollapply() to portions of a matrix
rcoder
- [R] History pruning
Ken Williams
- [R] 'system' command through Rserve
Patil, Prasad
- [R] bwplot with Date object
GOUACHE David
- [R] Query about finding correlations
Stefan Grosse
- [R] vertical bpplot
GOUACHE David
- [R] upgrade to 2.5
Sundar Dorai-Raj
- [R] instal tar.gz package on windows
georgiana onicescu
- [R] Randomly drawing observations from factors.
Economics Guy
- [R] strip names lattice graphics
GOUACHE David
- [R] upgrade to 2.5
Gabor Grothendieck
- [R] cutting out numbers from vectors
calundergrad
- [R] cutting out numbers from vectors
calundergrad
- [R] Randomly drawing observations from factors.
Marc Schwartz
- [R] Coarsening the Resolution of a Dataset
Steve Murray
- [R] History pruning
hadley wickham
- [R] strip names lattice graphics
Deepayan Sarkar
- [R] instal tar.gz package on windows
Marc Schwartz
- [R] Is R's fast fourier transform function different from "fft2" in Matlab?
Li Li
- [R] 'system' command through Rserve
Jeffrey Horner
- [R] Survival statistics--displaying multiple plots
Gregory Pierce
- [R] Problem with the installation of "install R" on Sun Solaris
Prof Brian Ripley
- [R] sort rows of matrix by rows of another matrix
Timothy W. Hilton
- [R] allocMatrix limits
Vadim Kutsyy
- [R] rollapply() to portions of a matrix
Gabor Grothendieck
- [R] dput vs unclass to see what a factor really is composed of
Jacob Wegelin
- [R] anisotropy in vgm model. HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Alessandro
- [R] instal tar.gz package on windows
Stefan Evert
- [R] Help with hazard plots
Alan Cox
- [R] Help with hazard plots
Alan Cox
- [R] allocMatrix limits
Prof Brian Ripley
Last message date:
Thu Jul 31 23:47:46 CEST 2008
Archived on: Sat Aug 2 16:39:08 CEST 2008
This archive was generated by
Pipermail 0.09 (Mailman edition).