[R] length of a string

[Chuck Cleland]

João Fadista wrote:
> Dear all,
>  
> I would like to know how can I compute the length of a string in a dataframe. Example:
>  
> SEQUENCE                               ID
> TGCTCCCATCTCCACGG            HR04FS000000645
> ACTGAACTCCCATCTCCAAT      HR00000595847847
>  
> I would like to know how to compute the length of each SEQUENCE.

?nchar

> Best regards,
> João Fadista
> 
> 	[[alternative HTML version deleted]]
> 
> 
> 
> ------------------------------------------------------------------------
> 
> ______________________________________________
> R-help at stat.math.ethz.ch mailing list
> https://stat.ethz.ch/mailman/listinfo/r-help
> PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
> and provide commented, minimal, self-contained, reproducible code.


-- 
Chuck Cleland, Ph.D.
NDRI, Inc.
71 West 23rd Street, 8th floor
New York, NY 10010
tel: (212) 845-4495 (Tu, Th)
tel: (732) 512-0171 (M, W, F)
fax: (917) 438-0894