[BioC] fasta biostrings bioconductor

[DNAStringSet Error Biostrings in R [guest]]

I posted this same quandary on Biostars and stack overflow.

I am attempting to import a fasta file of sequences into R using Bioconductor's 'Biostrings' package and the 'DNAStringSet' function but I keep getting the same error:

Error in .Call2("new_XString_from_CHARACTER", classname, x, start(solved_SEW),  : 
key 112 (char 'p') not in lookup table

My fasta file ("FileName.fa") is comprised of various length sequences, in the following format:

>GeneNameOne
CAGACACCCATAGATACAGATAGACAGATAGAGAAGACACCACCACACAATGA
>GeneNameTwo
CGCGACATGAACCCATGATAGACGATGAGACCCCACACACACC
...etc

I performed 'grep p FileName.fa' in the Unix terminal, but I received no output.

Does anyone have an idea on what is going on?

Thanks in advance. 

 -- output of sessionInfo(): 

Error in .Call2("new_XString_from_CHARACTER", classname, x, start(solved_SEW),  : 
key 112 (char 'p') not in lookup table

--
Sent via the guest posting facility at bioconductor.org.